1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids:

Q: Define exon and intron.

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: How many bases/nucleotudes make up a codon?

A: A nucleotide is a fundamental building block of nucleic acids, which include DNA (deoxyribonucleic…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: Contrast triplets, codons, and anticodons.

A: The organic molecules that contain an amino group, an acidic carboxyl group, and an organic side…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Describe how a polypeptide is synthesized (include what occurs at initiation, elongation and…

A: "The central dogma is the process by which genetic information is transferred from DNA to RNA in…

Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…

A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: Describe the process of translating mRNA into proteins. Be sure to also include the following key…

A: The translation is known as a process in which protein is synthesized through the mRNA (transcribed…

Q: Define degenerate code.

A: A codon is a three-nucleotide DNA or RNA sequence that codes for a particular amino acid. The…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The nearly universal genetic code consists of how many codons?

A: Genes are the unit of heredity and they are made up of triplet genetic codons. These codons are…

Q: Why may tRNA be considered the “interpreter” of the genetic code?

A: Introduction: RNA is a type of nucleic acid that is a genetic material in some viruses. There are…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: 1a) Name the start codon and the three stop codons for translation. 1b) What amino acid is…

A: An mRNA codon is a triplet or triple-nucleotide sequence that codes for a certain amino acid during…

Q: Place the steps of translation in sequence. In whatmolecules are codons and anticodons found? What…

A: Proteins are polypeptides that are made up of different types of amino acids. One amino acid is made…

Q: Define translation process?

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Give the initiation codon for protein synthesis. Name the amino acid it codes for?

A: A genetic codon is a three-nucleotide sequence of either DNA or RNA that corresponds to a particular…

Q: ribe the  crucial role of base pairing between codon and anticodon.

A: The hereditary material translated into messenger RNA is expressed by the triplet code (mRNA). The…

Q: xplain the events of translation initiation, elongation and termination

A: The translation is the process in which information in the mRNA is converted into amino acids and…

Q: Define genetic code.

A: A gene is a fundamental unit of heredity and a series of nucleotides in DNA or RNA. The DNA first…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Q: Describe the processes of initiation, elongation, and termination in polypeptide synthesis.

A: The process in which polypeptide chains are formed from coded amino acids in a cell is called…

Q: Distinguish between a codon and an anticodon.

A: GENETIC CODEGenetic code is a set of rules of codes through which information is translated from DNA…

Q: Briefly describe the events in translation.

A: The translation is one of the defined processes of the cell cycle. It is the last step in fact and…