Which of the following which of the following reactions is an endergonic reaction that could occur in a cell, but only if coupled to the hydrolysis of ATP? ( delta G= -32 kJ/ mol)?
Q: 1) What is the full name of the following molecule? 2) Briefly explain the functions of this…
A: The biochemistry of cells is greatly influenced by a variety of biological components. These…
Q: True statements regarding the TCA cycle EXCEPT Its metabolic product is ATP. It produces…
A: Citric acid cycle also known as kreb cycle or tricarboxylic acid cycle (TCA). This cycle occurs in…
Q: Does the presence of an uncompetitive inhibitor increase / decrease the apparent affinity of the…
A: Uncompetitive inhibition occurs when an inhibitor binds to an allosteric site of a enzyme, but only…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: 1.0 E oxygen saturation (Y) 0.6 0.4 0.2 0.0 20 40 60 blood pO₂ (torr) 80 100 120 for this picture…
A: Hemoglobin carries oxygen from the lungs to the tissues and CO2 from the tissues to the lungs. When…
Q: in the column chromatography of spinach extract Could you potentially see the usefulness of this…
A: INTRODUCTION : Column chromatography - It is a simple and the most popular separation and…
Q: Would you expect the structure of a competitive inhibitor of a given enzyme to be similar to that of…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: Acetyl-CoA is generated by E1 and E2 ... purpose of E3? (PDHC)
A: INTRODUCTION : Acetyl-CoA - It is a enzyme which is involved in many biochemical reactions of…
Q: In a hydrogen fuel cell, hydrogen gas and oxygen gas are combined to form water. Write the balanced…
A: Water molecule is a compound formed from hydrogen and oxygen gas. It has two Hydrogen atoms and one…
Q: impact on the number of electron carriers used by the electron transport chain? Select one: The…
A: Introduction Cellular respiration is of two types: aerobic respiration and anaerobic respiration.…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are classified into six classes. They are oxidoreductases, transferases, hydrolases,…
Q: What is most correct about the following inhibition? Penicillin
A: The antibiotic penicillin irreversibly binds to and inhibits the activity of the transpeptidase…
Q: Glyceraldehyde-3-phosphate + NAD+ + Pi → 1,3-bisphosphoglycerate + NADH + H+ ∆G0’ =+6.3 kJ…
A: In a general reaction such as: aA + bB ⇌ cC + dD The free energy changes in chemical reactions are…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Which technique would best seperate a protein that binds stongly to its substrate?
A: Chromatography is a technique that is used for separation of biological macromolecules form a…
Q: Which factor does NOT represent a barrier that prevents a reaction from taking place? substrate…
A: Reaction is a process by which a set of molecules is transformed to another. Many factors effect the…
Q: Ph.D Fernando, Harvard Professor of Genetic Epidemiology, knows a thing or two about Twins. He must…
A: S-adenosyl-methionine: It is a typical cosubstrate used in amino-propylation, transsulfuration,…
Q: The following scheme shows how acetylcholine esterase (AChE) enzyme hydrolyzes acetylcholine (ACh).…
A: A cholinergic enzyme called acetylcholinesterase (AChE) is mainly present in postsynaptic…
Q: Carbohydrates and proteins each generate 4kcal/g when oxidized in the bomb calorimeter but in…
A: Cellular respiration Cellular respiration is a collection of three metabolic pathways that generate…
Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…
A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…
Q: H K Br Br H trans-2,3-dibromo-2-butene cis-1,2-dibromoethene Otrans-1,2-dibromoethene…
A: The structure given the question represents- Answer- trans - 1,2- dibromoethene
Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…
A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…
Q: The production of amino acids from proteins is an example of: a. a non-enzymatic reaction b.…
A: Proteins are large molecular weight polymers of amino acids with diverse biological functions. Many…
Q: i) Re-arrange with the Michaelis Menten equation so it involves the ratio [S] Show all steps…
A: Michaelis-Menten equation A mathematical model called the Michaelis-Menten equation is used to…
Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…
A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…
Q: 385 What acts as a reductant in the glutamate synthase reaction to catalyze the transfer of the…
A: Reductant is a substance that donates electrons to another substance and reduce it. In an…
Q: In a Myoglobin and azide ligand-receptor binding experiment, instead of using 3.5 µM myoglobin you…
A: Myoglobin acts as oxygen reserve in the muscle cells. Myoglobin (Mb) has higher affinity towards…
Q: The following peptides were separated using ion-exchange chromatography based on the use of an anion…
A: Ion exchange chromatography separates fractions based on net charge. There are two types of ion…
Q: A positive biuret test would indicate the presence of what type of molecules in the filtrate
A: Biochemical tests are lab experiments conducted to determine the identity of an unknown analyte in a…
Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…
A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: What is an example of RNA editing? Changing a valine codon to a stop codon Methylation of cytosine…
A: Nucleic acids like DNA and RNA can be edited in various ways. Editing is done for various reasons…
Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…
A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…
Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…
A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…
Q: Analyze each item carefully and write your complete solution. Cysteine is an important amino acid…
A: Note: As per the honor code we are allowed to answer the first two questions. Kindly resubmit the…
Q: NH₂ Methyltransferases NH₂ OH OH S-Adenosylmethionine (SAM) Transamination B Phosphate transfer…
A: Methyl metabolism is well conserved across bacteria to humans. S-Adenosyl methionine (SAM) is…
Q: ● What are the three things we need to know in order to begin to understand the way an active site…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. The substrate binds…
Q: E mitochondria Question #: 25 While developing new inhibitors we came up with new compound, a…
A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…
Q: Which metabolic event is not in the mitochondria? Oxidation of fatty acids ETC…
A: Glycolysis is a the pathway in which glucose is broken down into two three-carbon compounds and…
Q: What is the pI, and how is it determined for amino acids that have nonionizable R groups?
A: There are twenty amino acids which are categorized as basic, acidic, aromatic, aliphatic, or sulfur-…
Q: Which coenzyme is NOT paired with its correct dietary precursor? thiamine → thiamine pyrophosphate…
A: Coenzymes are important in the metabolic pathways as they help enzymes in catalysing the reactions.…
Q: Relate the molecular properties to physicochemical properties of the following lauric acid stearic…
A: Lipids are chemically diverse group of biomolecules that have two common properties: they are…
Q: 384 Hemoglobin: Allostery and Evolution Q5.1 - 2,3-BPG is a negative allosteric regulator of…
A: Hemoglobin (Hb) is a protein that is found in red blood cells. A specific protein called haemoglobin…
Q: Place the following enzymes in the correct order of action RNA 5' triphosphatase RNA polymerase II…
A: The newly synthesised mRNA is called the primary transcript. Before the primary transcript can be…
Q: Kt of glucose for GLUT1=3 mM, GLUT2=17 mM, GLUT 3=1.3 mM, and GLUT11=0.3 mM. Sketch a graph with…
A: The equation that gives the rate of transport of molecule is similar to the rate equation of…
Q: In the corn snake Pantherophis guttatus, there are several different color variants, including…
A: Introns are non-coding sequences and exons are coding sequences in the gene. Splicing is the process…
Q: Which of the following proteins can BEST serve as a marker to detect the presence of the chloroplast…
A: The presence of biological or molecular markers provides information regarding their source.…
Q: ATP stock (50 µM): Make pre-dilutions with 20, 15, 10, 5, 2,5 and 1,25 µM ATP (1000 μL of each)…
A: Molarity is a way of representing the concentration of a solution. Molarity is the number of moles…
Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…
A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…
Q: Which of the following statements is FALSE regarding oxidative phosphorylation? The pH is higher in…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using the normal arterial blood gas values (pH = 7.35-7.45; Paco2 = 35-45 mm Hg; HCO3- = 22-26 mEq/L), identify both the primary disturbance and the degree of compensation for these three arterial blood gas readings: (a) pH = 7.20 (b) pH = 7.20 (c) pH = 7.36 Paco2 = 35 mm Hg Paco2 = 25 mm Hg Paco2 = 20 mm Hg [HCO3-] = 17 mEq/L [HCO3-] = 17 mEq/L [HCO3-] = 17 mEq/LIV D5W/NS with 20 mEq KCL 1,000 mL/8 hr Allopurinol 200 mg PO tid Fortaz 1 g IV q6h Aztreonam (Azactam) 2 g IV q12h Flagyl 500 mg IV q8h Acetaminophen two tablets q4h prn A.Calculate mL/hr to set the IV pump. B. Calculate how many tablets of allopurinol will be given PO. Supply: 100 mg/tablet. C. Calculate how many mL/hr to set the IV pump to infuse Fortaz. Supply: 1-g vial to be diluted 10 mL of sterile water and further diluted in 50 mL NS to infuse over 30 minutes. D. Calculate how many mL of aztreonam to draw from the vial. Supply: 2-g vial to be diluted with 10 mL of sterile water and further diluted in 100 mL NS to Infuse over 60 minutes. E. Calculate how many mL/hr to set the IV pump to infuse Flagyl. Supply: 500 mg/100 mL to infuse over 1 hour.Doctor's Order: Nafcillin 500 mg po pc; Available: Nafcillin 1 gm tab (scored). How many tab will you administer per day? a. 2.5 tabs IF b. 2 tabs c. 1.5 tabs d. 1 tab ANSWER: COMPUTATION : Doctor's Order: Synthroid 75 mcg po daily; Available: Synthroid 0.15 mg tab (scored). How many tab will you administer? 1 tab a. b. 0.5 tab c. 2 tabs d. 1.5 tabs ANSWER: COMPUTATION : Doctor's Order: Diuril 1.8 mg/kg po tid; Available: Diuril 12.5 mg caps. How many cap will you administer for each dose to a 31 lb child? a. 2 caps b. 2.5 caps c. 3 caps d. 1.5 caps ANSWER: COMPUTATION : Doctor's Order: Cleocin Oral Susp 600 mg po qid; Directions for mixing: Add 100 mL of water and shake vigorously. Each 2.5 mL will contain 100 mg of Cleocin. How many tsp of Cleocin will you administer? 3 tsp 5 tsp 3.5 tsp a. b. c. d. 1 tsp ANSWER: MPUTATION:
- Choose between 0.8, 5, 10 or 15 ng/LGiven the following ABG (arterial blood gas) values for an asthmatic patient, what is your diagnosis? Briefly explain how you came to that diagnosis. pH = 7.33 (normal range: 7.38-7.42 PaCO2 = 55 mm Hg (normal range: 38-42 mm Hg) HCO3– = 25 mEq/L (normal range: 22-28 mEq/L) PaO2 = 70 mm Hg (normal range: 75-100 mm Hg)152+(8.635x102 )+(0.021x103 )
- A drug with an elimination half-life of 1 hour was given to a male patient weighing 60 g by IV at rate of 300 mg/hr. at 7 hours after infusion, the plasma drug concentration was 11 mcg/mL. (PROVIDE SOLUTION) 1. What is the total body clearance in mL/hr? a. 27, 274.00 mL/hr b. 27, 272.72 mL/hr c. 27, 772.02 mL/hr d. 27, 773.00 mL/hrDetermine the % inaccuracy by calculating the percent error of the micropipette at the set volume of 100 µL A. Standard deviation B. Covieffecrnt of varaiant C. % error (precision) Percent error = mean volume delivered -expected volume x 100 Expected volume RUN Weight Measurement (in g) 1 0.0985 2 0.0987 3 0.0985 4 0.0982 5 0.0984 6 0.0984 7 0.0981 8 0.0983 9 0.0982 10 0.0988 Total 0.9841 A. Standard deviation B. Covieffecrnt of varaiant C. % error (precision)A child weighing 22 lbs, has an infection and the doctor orders erythromycin drops 2.0 mLp.o. q6h. The bottle states that the usual dosage is 20.0-40.0 mg/kg/day, and there are35.0 mg per 1.5 mL. Find the min and max dosage per day in mL. Is the order within therecommended dosage?
- When determining CFUs for a dilution of the same sample at 10-2 and 10-3 which of the following results would seem the most accurate to you? Explain why in the space below. A. 110,000 CFU/mL for 10-2; and 140,000 CFU/mL 10-3 B. 110,000 CFU/mL for 10-2; and 14,000 CFU/mL 10-3 C. 10,000 CFU/mL for 10-2; and 140,000 CFU/mL 10-3 D. none of the aboveAssuming a normal barometric pressure of 760 mm Hg, if the percentage of oxygen is 0.4, the partial pressure of oxygen would be: A. 159 mm Hg C. 304 mm Hg B. 215 mm Hg D. 560 mm HgMatch the Law/Effect with its definition/description A. Boyle’s Law B. Henry’s Law C. Dalton’s Law D. Haldane Effect E. Bohr Effect 1. The pressure of a gas is inversely proportional to its volume 2. A lower, more acidic pH promotes oxygen dissociation from hemoglobin 3. Hemoglobin saturated with oxygen has a low affinity for carbon dioxide 4. The concentration of a gas in a liquid is directly proportional to the solubility and partial pressure of that gas 5. The total pressure exerted by a mixture of gases is the sum of the partial pressures of the gases in the mixture