A certain enzyme was altered by site-specific mutagenesis in an attempt to improveits efficiency. To determine whether this manipulation has succeeded or not, kineticstudies are performed on a wild-type enzyme from E. coli and the engineeredenzyme expressed in P. pastoris. The following table shows the results.va (mM/min)wild-typeCsa (mM)variant0.295.8317.60.529.0224.60.8112.823.91.4817.023.93.1020.127.24.9827.927.77.0531.427.9a) Determine Km and vmax for each enzyme.b) Compare the kinetic properties of the enzymes when Cs = 150 µM. Is there adifference? Explain.c) Compare the catalytic efficiencies (vmax/Km) of the enzymes. Did site-specificmutagenesis succeed in improving the enzyme?

The kinetic analysis of the given data can be done via plotting a Lineweaver Burk plot. The…

Answered: A certain enzyme was altered by…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

28. In a transformation experiment, DNA is collected from an E. coli donor strain of genotype cys(+) leu(-) thr(+) and used to transform a recipient of genotype cys(-) leu(+) thr(-). Initially, the treated recipient population is plated on a minimal medium supplemented with threonine. Many colonies are obtained. What are possible genotypes of these colonies? A. cys(-) leu(+) thr(+) B. cys(+) leu(+) thr(-) C. All are cys(+) and either + or - for leu and thr D. All are thr(+) and either + or - for cys and leu E. All are thr(-) cys(-) and either + or - - for CYS
a- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5866609/pdf/pnas.201800195.pdfb- (Article is no longer available) Here are the articles provided within the question - They are not needed but are available if additional information is warranted - The figures being mentioned are already provided. This is Biochemoistry, please answer each part to the best of your ability. There are a max of 3 parts due to guidelines and please answer each part with clear and efficient work with answers. Thank you
The abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The average CT values were 14.6, 20.2, and 10.5 for transcripts A, B, and C, respectively. Determine the relative order of abundance of the transcripts. Name one technique that could be used to confirm that the order of abundance at the mRNA transcript level is reflected at the protein level.
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. What type(s) of mutation may have occurred in the GS1 gene in strain A?
answer c only
Give the levels of Beta-galactosidase activity (high or low or zero) expected for the following partial diploids for the lac operon strains.
You have a leu auxotroph strain of e. coli. You suspect that if you mutagenize this strain, you can isolate prototrophic revertants. You irradiate these cells to generate mutants. A) What media should you plate these mutants on to identify leu prototrophs? answers: a. minimal media + carbon source b. minimal media - leu c. rich media d. rich media + ampicillin e. rich media -trp
In the example two site system for DctD₂ binding to the dctA enhancer element, what was done to sharpen the error surface for the wild type DNA fragment (plotted on the left), giving the much more informative plot on the right? UPOWRA Variance of Fit vs Free Energy for Parameters Gee's Free Energy PERSOALAN BOXE 4.00 2005 0:02 2015 6:01 1.005 44 20 Verlance of Fit us Free Energy Paramete -16 G's free g O the experiment was repeated many times to improve the precision of the measurements O global analysis with wild type DNA and a fragment bearing a 5 base-pair insertion between the sites the intrinsic energy of binding for sites A and sites B were first extracted for a DNA fragment with a 5 bp insertion between the two sites, and then those parameter values were used as known quantities in analysis of the data for wild type DNA template
You have constructed a recombinant vector harbouring pyruvate kinase. Subsequently, youwish to introduce your recombinant vector into Arabidopsis plants, since the enzyme isessential for the production of oil in developing seeds of Arabidopsis thaliana and oil crops.Explain how could you produce a transgenic Arabidopsis plant harbouring your syntheticgene by Agrobaterium tumefaciens-mediated transformation?
A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
Besides the examples listed in Table 24.3, list five types ofshort sequences that a geneticist might want to locate withina DNA sequence.
. You need to prepare 500 μL of a 250 µg/mL bovine gamma globulin solution, for one of your protein standards in the Bradford assay. The available bovine gamma globulin in the lab is in the form of a 2 mg/mL stock solution, and it can be diluted with deionized water. Describe or show below how you would create your desired 250 µg/mL solution.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS