Mutation analysis of GCK gene in patients with diabetes revealed a c.114 TA (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGC TGAGGCCACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAG AATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAG GCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence Nar I GG/CGCC Dde I c/TNAG www Hae III NGCGC/n Cc/GG Hpall Alul AG/CT Smal ССС/GGG Mbol /GATC Mae III wwww /GTNAC Bsp 1286 I GnGCn/C ww Hind III A/AGCTT EcoR I G/AATTC wwm n: any nucleotide /: cutting site
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
![Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T A (shown in bold
and underlined) substitution in heterozygote state. In order to check the mutation in healthy
individuals, restriction enzyme analysis will be used.
a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate
which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table
1 shown below.
b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and
heterozygote individual after restriction enzyme analysis.
ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGC
TGAGGCCACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAG
AATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAG
GCTAGGATGTGA
Figure 1. GCK gene sequence. Length of the fragment is 213bp.
Table1. The restriction enzymes and their recognition sequences.
Restriction enzyme
Recognition seguence
Nar I
GG/CGCC
Dde I
c/TNAG
wwwww
Hae IlI
NGCGC/n
wwww
Hpall
c/GG
Alul
AG/CT
Smal
ССС/GGG
Mbol
/GATC
Маe II
/GTNAC
ww
Bsp 1286 I
GnGCn/C
Hind III
A/AGCTT
EcoR I
G/AATTC
n: any nucleotide
/: cutting site](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F85e2d83c-7426-4be6-b623-56d58845962e%2F3f71565d-2012-4e36-b4e2-9f5180ede84d%2F0owpmbk_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)