A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. The scientist determines the nucleotide sequence of the coding strand of the GS1 gene from strain A. It is identical to the GS1 sequence from the wild type gene except for a single change occurring approximately 1⁄3 of the way into the GS1 open reading frame. A small region of the GS1 sequence (including the site where the mutation occurs) from the wild type and mutant strains is shown below. Wild type TGTCCTCGGCCACAAGTTCTCTATC Strain A TGTCCTCGGCCACTAGTTCTCTATC How has this mutation produced the smaller GS1 protein in strain A? Using the genetic code (Fig. 1.), deduce the amino acid sequence of the wild type GS1 protein corresponding to the short piece of DNA shown above
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.


Step by step
Solved in 3 steps









