Homework Help is Here – Start Your Trial Now!
Science
Biology
5' TTAGTCGCTAAACGTCCCTTTCATTCTCCCTTGAAGATATG 3' AATCAGCGATTTGCAGGGAAAGTAAGAGGGAACTTCTATAC ↓ +1 3rd position (3' end) ↓ 1st position (5' end) 2nd position UC A G Phe Ser Tyr Phe Ser Tyr Cys Cys Leu Ser STOP STOP Leu Ser STOP Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg AL UCAG А G UCAC lle Thr Asn Ser lle Thr Asn Ser lle Thr Lys Arg Met Thr Lys Arg с UCAC UCAG SCAO Val Ala Asp Gly Val Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly G entions Associated with the Standard Amino Acids PK, values Abbreviated names M, pk₁ (-COOH) pK₂ (-NH3) V PKR (R group) pl Hydropathy index" Occurrence in proteins (%) Gly G 75 2.34 9.60 5.97 -0.4 7.2 Ala A 89 2.34 9.69 6.01 1.8 7.8 Pro P 115 1.99 10.96 6.48 1.6 5.2 Val 117 2.32 9.62 5.97 4.2 6.6 Leu L 131 2.36 9.60 5.98 3.8 9.1 lle 131 2.36 9.68 6.02 4.5 5.3 Met M 149 2.28 9.21 5.74 1.9 2.3 Phe F 165 1.83 9.13 5.48 2.8 3.9 Tyr Y 181 2.20 9.11 10.07 5.66 -1.3 3.2 Trp W 204 2.38 9.39 5.89 -0.9 1.4 Ser S 105 2.21 9.15 5.68 0.8 6.8 Thr T 119 2.11 9.62 5.87 0.7 5.9 Cys C 121 1.96 10.28 8.18 5.07 2.5 1.9 Asn N 132 2.02 8.80 5.41 3.5 4.3 Gln Q 146 2.17 9.13 5.65 -3.5 4.2 Lys K 146 2.18 8.95 10.53 9.74 3.9 5.9 His H 155 1.82 9.17 6.00 7.59 3.2 Arg R 174 2.17 9.04 12.48 10.76 25 2.3 5.1 Asp D 133 1.88 9.60 3.65 2.77 3.5 5.3 Glu E 147 2.19 9.67 4.25 3.22 -3.5. 6.3 obicity and hydrophilicity of R groups; it can be used to measure the tendency of an amino acid to seek an aqueous environment Dial 157 105 132

5' TTAGTCGCTAAACGTCCCTTTCATTCTCCCTTGAAGATATG 3' AATCAGCGATTTGCAGGGAAAGTAAGAGGGAACTTCTATAC ↓ +1 3rd position (3' end) ↓ 1st position (5' end) 2nd position UC A G Phe Ser Tyr Phe Ser Tyr Cys Cys Leu Ser STOP STOP Leu Ser STOP Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg AL UCAG А G UCAC lle Thr Asn Ser lle Thr Asn Ser lle Thr Lys Arg Met Thr Lys Arg с UCAC UCAG SCAO Val Ala Asp Gly Val Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly G entions Associated with the Standard Amino Acids PK, values Abbreviated names M, pk₁ (-COOH) pK₂ (-NH3) V PKR (R group) pl Hydropathy index" Occurrence in proteins (%) Gly G 75 2.34 9.60 5.97 -0.4 7.2 Ala A 89 2.34 9.69 6.01 1.8 7.8 Pro P 115 1.99 10.96 6.48 1.6 5.2 Val 117 2.32 9.62 5.97 4.2 6.6 Leu L 131 2.36 9.60 5.98 3.8 9.1 lle 131 2.36 9.68 6.02 4.5 5.3 Met M 149 2.28 9.21 5.74 1.9 2.3 Phe F 165 1.83 9.13 5.48 2.8 3.9 Tyr Y 181 2.20 9.11 10.07 5.66 -1.3 3.2 Trp W 204 2.38 9.39 5.89 -0.9 1.4 Ser S 105 2.21 9.15 5.68 0.8 6.8 Thr T 119 2.11 9.62 5.87 0.7 5.9 Cys C 121 1.96 10.28 8.18 5.07 2.5 1.9 Asn N 132 2.02 8.80 5.41 3.5 4.3 Gln Q 146 2.17 9.13 5.65 -3.5 4.2 Lys K 146 2.18 8.95 10.53 9.74 3.9 5.9 His H 155 1.82 9.17 6.00 7.59 3.2 Arg R 174 2.17 9.04 12.48 10.76 25 2.3 5.1 Asp D 133 1.88 9.60 3.65 2.77 3.5 5.3 Glu E 147 2.19 9.67 4.25 3.22 -3.5. 6.3 obicity and hydrophilicity of R groups; it can be used to measure the tendency of an amino acid to seek an aqueous environment Dial 157 105 132

Human Heredity: Principles and Issues (MindTap Course List)
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter10: From Proteins To Phenotypes
Section: Chapter Questions
Problem 14QP: If phenylalanine was not an essential amino acid, would diet therapy (the elimination of...
See similar textbooks
icon
Related questions
Question

The following shows nucleotide sequence of a prokaryotic gene encoding small peptide. The block arrow indicates promoter. 1) What is the amino acid sequence of the peptide synthesized in bacterial cytoplasm? (Use codon table below.) 2) Write the full names of amino acids comprising the synthesized peptide. 3) What is the net charge of the synthesized peptide at neutral pH?

5' TTAGTCGCTAAACGTCCCTTTCATTCTCCCTTGAAGATATG 3' AATCAGCGATTTGCAGGGAAAGTAAGAGGGAACTTCTATAC ↓ +1 3rd position (3' end) ↓ 1st position (5' end) 2nd position UC A G Phe Ser Tyr Phe Ser Tyr Cys Cys Leu Ser STOP STOP Leu Ser STOP Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg AL UCAG А G UCAC lle Thr Asn Ser lle Thr Asn Ser lle Thr Lys Arg Met Thr Lys Arg с UCAC UCAG SCAO Val Ala Asp Gly Val Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly G entions Associated with the Standard Amino Acids PK, values Abbreviated names M, pk₁ (-COOH) pK₂ (-NH3) V PKR (R group) pl Hydropathy index" Occurrence in proteins (%) Gly G 75 2.34 9.60 5.97 -0.4 7.2 Ala A 89 2.34 9.69 6.01 1.8 7.8 Pro P 115 1.99 10.96 6.48 1.6 5.2 Val 117 2.32 9.62 5.97 4.2 6.6 Leu L 131 2.36 9.60 5.98 3.8 9.1 lle 131 2.36 9.68 6.02 4.5 5.3 Met M 149 2.28 9.21 5.74 1.9 2.3 Phe F 165 1.83 9.13 5.48 2.8 3.9 Tyr Y 181 2.20 9.11 10.07 5.66 -1.3 3.2 Trp W 204 2.38 9.39 5.89 -0.9 1.4 Ser S 105 2.21 9.15 5.68 0.8 6.8 Thr T 119 2.11 9.62 5.87 0.7 5.9 Cys C 121 1.96 10.28 8.18 5.07 2.5 1.9 Asn N 132 2.02 8.80 5.41 3.5 4.3 Gln Q 146 2.17 9.13 5.65 -3.5 4.2 Lys K 146 2.18 8.95 10.53 9.74 3.9 5.9 His H 155 1.82 9.17 6.00 7.59 3.2 Arg R 174 2.17 9.04 12.48 10.76 25 2.3 5.1 Asp D 133 1.88 9.60 3.65 2.77 3.5 5.3 Glu E 147 2.19 9.67 4.25 3.22 -3.5. 6.3 obicity and hydrophilicity of R groups; it can be used to measure the tendency of an amino acid to seek an aqueous environment Dial 157 105 132
Transcribed Image Text:5' TTAGTCGCTAAACGTCCCTTTCATTCTCCCTTGAAGATATG 3' AATCAGCGATTTGCAGGGAAAGTAAGAGGGAACTTCTATAC ↓ +1 3rd position (3' end) ↓ 1st position (5' end) 2nd position UC A G Phe Ser Tyr Phe Ser Tyr Cys Cys Leu Ser STOP STOP Leu Ser STOP Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg AL UCAG А G UCAC lle Thr Asn Ser lle Thr Asn Ser lle Thr Lys Arg Met Thr Lys Arg с UCAC UCAG SCAO Val Ala Asp Gly Val Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly G entions Associated with the Standard Amino Acids PK, values Abbreviated names M, pk₁ (-COOH) pK₂ (-NH3) V PKR (R group) pl Hydropathy index" Occurrence in proteins (%) Gly G 75 2.34 9.60 5.97 -0.4 7.2 Ala A 89 2.34 9.69 6.01 1.8 7.8 Pro P 115 1.99 10.96 6.48 1.6 5.2 Val 117 2.32 9.62 5.97 4.2 6.6 Leu L 131 2.36 9.60 5.98 3.8 9.1 lle 131 2.36 9.68 6.02 4.5 5.3 Met M 149 2.28 9.21 5.74 1.9 2.3 Phe F 165 1.83 9.13 5.48 2.8 3.9 Tyr Y 181 2.20 9.11 10.07 5.66 -1.3 3.2 Trp W 204 2.38 9.39 5.89 -0.9 1.4 Ser S 105 2.21 9.15 5.68 0.8 6.8 Thr T 119 2.11 9.62 5.87 0.7 5.9 Cys C 121 1.96 10.28 8.18 5.07 2.5 1.9 Asn N 132 2.02 8.80 5.41 3.5 4.3 Gln Q 146 2.17 9.13 5.65 -3.5 4.2 Lys K 146 2.18 8.95 10.53 9.74 3.9 5.9 His H 155 1.82 9.17 6.00 7.59 3.2 Arg R 174 2.17 9.04 12.48 10.76 25 2.3 5.1 Asp D 133 1.88 9.60 3.65 2.77 3.5 5.3 Glu E 147 2.19 9.67 4.25 3.22 -3.5. 6.3 obicity and hydrophilicity of R groups; it can be used to measure the tendency of an amino acid to seek an aqueous environment Dial 157 105 132
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS