The mRNA strand is synthesized in the 5' to 3' direction. 5' and 3' indicate the number of carbons in the sugar (ribose or deoxyribose). O True ཊཤུ། O False
Q: +…
A: An animal with an irregular shape that cannot be divided into two equal halves has asymmetry.When an…
Q: None
A: Let's do this step-by-step with the given data:1. Identify the relevant coloniesWe need to find…
Q: Answer A, B, C
A: A) Epidermis.=> Epidermis is the outermost layer of the skin. B) Sebaceous gland.=> Sebaceous…
Q: Part B - Identifying functional groups in a molecule The molecule shown here contains four…
A: The molecule shown contains the following functional groups:1. Thiol group (-SH): This group…
Q: PART 2: Breeding Value, Gene Combination Value, Expected Progeny Difference For this part, you will…
A: Gene Combination Value (GCV):Think of GCV as the raw genetic potential an animal inherits from its…
Q: Why shouldn't electronic health records be made available to current or potential employers? Include…
A: Electronic Health Records (EHRs) are digital versions of patients' paper charts. They contain all…
Q: The level of this hormone exhibits circadian variation ○ Adrenalin Cortisol ○ Insulin ○ Glucagon ○…
A: Cortisol is the hormone that exhibits circadian variation. Its levels fluctuate throughout the day,…
Q: What is one current controversy surrounding abortion? Summarize in two paragraphs.
A: One of the most significant controversies surrounding abortion is the debate over when life begins.…
Q: This week you were introduced to the concept of walkability and the impact that environmental…
A: First, visit the Walkscore website and enter the name of your selected community, in this case,…
Q: None
A: Loss of exocyclic amino group:This option is correct because the reaction involves the removal of an…
Q: b. Balance the following redox reaction under basic conditions. HO Cr(OH) Cro OH
A: Step 1: Separate the Half-ReactionsOxidation Half-Reaction:HO2−→ O2Reduction…
Q: None
A: To determine the false statement about base excision repair (BER) in eukaryotes, let's analyze each…
Q: Not all answers are gonna be used but answer for the letters provided in the image. Thanks.
A: Step 1An organ of the inner ear is named as the cochlea, which is spiral-shaped.Its histological…
Q: None
A: Explanation of Each Step in Diagram1. Auxin Binding:Auxin molecules are transported to the cell.They…
Q: Basidiospores Basidia Hymenium Peridium Ascospores Asci Apothecium Mycelium Algal Cells COPRINUS…
A: Refer to the solution
Q: queen. Cuckoo bumblebees take advantage of 'true' bumblebees by parasitizing their nests. A female…
A: The two types of parasitic strategies used by the cuckoo bumblebee are: 1. **Brood parasitism**: The…
Q: This graph illustrates a(n) reaction. Potential energy of molecules endergonic spontaneous ○…
A: The graph in the image illustrates a reaction where the products have a higher potential energy than…
Q: True or Flase: Evolution through natural selection can NEVER be observed because it happens too…
A: Evolution is a process that results in changes in the genetic material of a population over time. It…
Q: Ulaskitech.blackboard.com/ultra/courses/_48169_1/grades/assessment/_5455786_1/overview/attempt/_9052…
A: Gram staining is a test that checks for bacteria at the site of a suspected infection such as the…
Q: Explain about the difference between the kidney of ox and that of horse
A: The kidneys are vital organs in the body that play a crucial role in filtering waste products,…
Q: Which of these models correctly identifies the most recent common ancestor diploblasts? Cnidaria…
A: The image presents 4 different phylogenetic models that depict the evolutionary relationships among…
Q: QC271. An aquifer has following different formations, their thickness and Hydraulic conductivity are…
A: Approach to solving the question: through using the data given. Detailed explanation:Ki*Hi…
Q: (c) cvenglarik/jscc Identify the organ outlined in red
A: Swim bladder (also known as the air bladder) is a characteristic organ of most species of fish. It…
Q: Show work. don't use Ai for answering this
A: 1.Out of 4 children, 2 are affected. Therefore: 2 / 4 = 0.5 or 1/2 2. In the pedigree chart,…
Q: Discuss and explain a nutritional guideline or need that is different between men and women. Why is…
A: One significant nutritional difference between men and women is the requirement for iron. Iron is a…
Q: Show work. Don't use Ai for answering this..if u use I will give you down vote
A: Pathway a:Mutation 1 → Metabolite A (absent, hence 0)Mutation 2 → Metabolite C (present, hence…
Q: living organisms are descended from _______________ ancestors.
A: In biology, the concept of descent refers to the process by which characteristics and traits are…
Q: Please identify the Minutiae in the diagram. I am sending you the Minutiae characteristics.
A: Converging Ridges:Description: Two ridges meet at a point.Label: 9 Divergent Ridges:Description: Two…
Q: You performed an evil experiment and ended up with a panda, turtle, and butterfly hybrid (By all…
A: To remove the evidence of the hybrid creature as quickly as possible, you would need to accelerate…
Q: Answer the following question from the photo below with one paragraph each.
A: ORIGINAL DNA SEQUENCE:Template strand: 3' TCG TTA GGC AGA ACC 5'Coding strand: 5' AGC AAT CCG TCT…
Q: None
A: Here's an explanation for the results typically observed in the nitrate reduction test for each…
Q: Match the terms with letters to complete the sentences on the right. When molecules move down their…
A: Approach to solving the question: The answers are from the sources linked below. Key…
Q: In response to an increasingly high mortality rate in association with motorcycle accidents, public…
A: The core functions of public health are generally divided into three categories: Assessment, Policy…
Q: 6. In the space below draw the lactose operon in an environment that LACKS lactose. On your image…
A: The LAC operon consists of one regulatory gene, the i gene and three structural genes( z, y, a). The…
Q: Do not use Ai and chatgpt
A: Contact transmission can be direct or indirect through physical contact with either an infected host…
Q: After 20 minutes of incubation at 32°C, you measure the bubble height of CO2 gas collected in a…
A: To solve this problem, we need to use the information provided about the bubble height and the…
Q: Choose a challenging scientific article from a scientific journal that relates to a topic Green…
A: Solution:CitationNogueira, L. S., Crémazy, A., & Wood, C. M. (2024). The role of the carapace in…
Q: An aquatic community with marshland conditions, the most common plant species being bulrush, and the…
A: Approach to solving the question: Detailed explanation:In ecology, naming communities typically…
Q: Question 1 (1 point) The intestines are responsible for passively absorbing water that has been…
A: The question is about the relationship between body cells and the solution moving through the…
Q: take all of this information and turn it into a topic Note: make sure that it is a topic; no…
A: Blood is composed of various components that each have important functions in the body. Red blood…
Q: Here is a diagram of an amino acid. Explain how the peptide bond is formed between two amino acids.…
A: An amino acid is composed of an amino group (-NH2), a carboxyl group (-COOH), a hydrogen atom (-H),…
Q: If global temperatures keep rising, which area will be most affected/heat up quickest? Group of…
A: To provide what is best and to understand more about the students concerns for their studies.
Q: For each of the following scenarios describing gene annotation, choose the answer that best fits A…
A:
Q: None
A: Key references: Biology
Q: Evolution is a change in allele frequencies in a population. True False
A: Evolution, in the context of biology, refers to the process by which populations of organisms change…
Q: PLEASE HELP!!
A: Approach to Solving the Question:Familiarize with Grasshopper Anatomy: Review basic anatomy and…
Q: 30 3 points Select each of the following features that are common to the citric acid cycle and the…
A:
Q: In a grassland ecosystem, scientists manipulate the nutrient levels in the soil. They observe that…
A: why the other selections are incorrect:Bottom-up control: Increased predator populations diminish…
Q: Can you help me with this research paper topic? Note: make sure to have this Chronic Obstructive…
A: Research Paper Topic: The Role of Environmental and Genetic Factors in the Development and…
Q: Otto Warburg and his coworkers first described “aerobic glycolysis”, which has come to be known as…
A: Key Differences in Cancer Cells:Increased Glycolysis: Even in aerobic environments, cancer cells…
Step by step
Solved in 2 steps
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.DNA, TRNA, FRNA and MRNA contain the genetic code O True O false
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for the mRNA transcribed is O ACU O UUU O UGA O UAC OTCA5 T G T T A G T C G A A T 3 what is the complimentary dna and complimentary mRNA
- A ribonucleotide consists of a nucleobase (e.g. guanine, uracil) 33 Minutes, g connected to a ribose that is phosphorylated at the 5' position. O True ne O FalseHere is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
- 22 e, 23A and 23b pleaseA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.What amino acid sequence is coded by the following mRNA base sequence?