A scientist is using polymerase chain reaction (PCR) to amplify the section of DNA shown in the Transcription and Translation interactive. Which primer would the scientist use to make a copy of the stretch of DNA that is complementary to the template strand? 5' GCUCAGC 3' 5' GAAUGAC 3' 5' GCTCAGC 3' 5' GAATGAC 3' Incorrect

The schematic dlagram below shows the functional organization of transcribing RNA polymerase. Match parts of the diagram (labeled A-G) with the corresponding term from the answer list (design ated 1-12). Polymerase movement ANA POLYMERASE A Rowinding of DNA Unwinding of DNA E NTPs Note that some of the items from the answer list should NOT be used. Labels E and F point to the specific ends of DNA/RNA molecules. 1. Template strand 2. RNA transcript 3. Replication origin 4 Non-Template strand 5. Leading strand 6. 3 end 7. Primer 8. Replication fork 9. Transcription bubble 10. 5' end 11. DNA RNA nybrid 12. Lagging strand

describe this picture in simple words please.

Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’

There are five options

Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )

For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA).   5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’

What is the enzyme used to create DNA complementary to mature mRNA? Group of answer choices ligase topoisomerase DNA polymerase reverse transcriptase RNA polymerase transposase

You are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?

The following are the restriction enzyme sequences. The slash indicates the cut in the DNA sequence. EcoRI: 5' G/AATTC 3' Hind IlI: 5' AG/GATCC 3' Bam Hl: 5' G/GATCC 3' For DNA sequences 1,2 and 3 (below) Write the 3' to 5' DNA bottom strand • Write the mRNA sequence of top strand Write the mRNA sequence of bottom strand Write the Protein sequence of the Bottom strand • Which enzyme should be used to differentiate (detect the mutation) in sequence 2 1) cac agt aca tca gac atg gat cca agc cca tgt ata ccc cg aac 2) cac agt aca tca gac atg gtT cca agc cca tgt ata ccc ccg aac 3) cac agt aca tca gac atg gaC cca agc cca tgt ata ccc ccg aac Edit View Insert Format Tools Table 12pt v Paragraph