Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN: 9781305389892
Author: Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 16.3, Problem 2SB
Summary Introduction
To review:
The effect on the translation of the mRNA when the poly-A tail on the mRNA is eliminated.
Introduction:
The central dogma states that information flows from the DNA to the synthesis of the protein. In this, the DNA is converted into the RNA through the process of transcription, which undergoes the process of posttranscriptional modification and gives rise to the mRNA that further moves into the process of translation and produces the protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
what would happen if there were no 5' cap in order to make mRNA recognizable?
Chapter 16 Solutions
Biology: The Dynamic Science (MindTap Course List)
Ch. 16.1 - Suppose the lacl gene is mutated so that the Lac...Ch. 16.1 - Answer the equivalent question for the trp operon:...Ch. 16.2 - What is the role of histones in gene expression?...Ch. 16.2 - Prob. 2SBCh. 16.3 - Prob. 1SBCh. 16.3 - Prob. 2SBCh. 16.4 - Prob. 1SBCh. 16.4 - Prob. 2SBCh. 16.5 - Prob. 1SBCh. 16.5 - Prob. 2SB
Ch. 16.5 - Prob. 3SBCh. 16.5 - Prob. 4SBCh. 16 - Prob. 1TYKCh. 16 - For the E. coli lac operon, when lactose is...Ch. 16 - Prob. 3TYKCh. 16 - Prob. 4TYKCh. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - Prob. 7TYKCh. 16 - Prob. 8TYKCh. 16 - Prob. 9TYKCh. 16 - Prob. 10TYKCh. 16 - Discuss Concepts In a mutant strain of E. coli,...Ch. 16 - Prob. 12TYKCh. 16 - Prob. 13TYKCh. 16 - Prob. 14TYKCh. 16 - Design an experiment using rats as the model...Ch. 16 - Prob. 1ITDCh. 16 - Prob. 2ITDCh. 16 - Prob. 3ITDCh. 16 - Prob. 4ITD
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forwardHow many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?arrow_forwardAGGTATCGCAT is a sequence from the coding strand of a gene. What will bw the corresponding sequence of the transcribed Mrna?arrow_forward
- : (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asaparrow_forwardA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forward17) Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the mRNA? A) addition of the 3’ polyadenylated tail B( splicing together if exons C removal of introns D RNA editing E addition of the 7- methlgguanosine cap to the 5’ end arrow_forward
- If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?arrow_forwardDescribe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA, singlestranded (1)DNA, single-stranded (2)DNA, singlestranded (1)RNA, and single-stranded (2)RNA.arrow_forwardGiven the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forward
- A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?arrow_forwardDerive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA GAG GUA UCC UAC AGA 3' 5' GUC AUC UGG AGG GGC AUU 3' 5' CUA UGC AGU AGG ACA CCCarrow_forwardThe following segment of mRNA encodes an interstitial segment of a polypeptide (thedifferent codons appear separately): 5'... AAU CUA UUC AUU AAA ACC ... 3'a) Determine the sequence of the two strands of the DNA fragment from which this RNA comes. highlighting the sense and antisense strandb) What will be the corresponding amino acid sequence that originates in the translationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY