Brock Biology of Microorganisms (14th Edition)
Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
bartleby

Videos

Textbook Question
Book Icon
Chapter 11, Problem 2AQ

Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?

Blurred answer
Students have asked these similar questions
Arrange the steps that would be used in a laboratory to engineer a bacterium that could express the human gene coding for factor VIII. (Not all steps will be placed).
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…
In bacteria, genes that are often used together are controlled by a single promoter. Explain why this is the case.

Chapter 11 Solutions

Brock Biology of Microorganisms (14th Edition)

Ch. 11.5 - Prob. 1MQCh. 11.5 - How can site-directed mutagenesis be useful to...Ch. 11.5 - What are knockout mutations?Ch. 11.6 - Prob. 1MQCh. 11.6 - Prob. 2MQCh. 11.7 - Prob. 1MQCh. 11.7 - Prob. 2MQCh. 11.7 - Prob. 3MQCh. 11.8 - Prob. 1MQCh. 11.8 - Prob. 2MQCh. 11.9 - MINIQUIZ • Describe the components needed for an...Ch. 11.9 - Prob. 2MQCh. 11.10 - Prob. 1MQCh. 11.10 - Prob. 2MQCh. 11.10 - Prob. 3MQCh. 11.11 - What major advantage does cloning mammalian genes...Ch. 11.11 - Prob. 2MQCh. 11.12 - Prob. 1MQCh. 11.12 - Prob. 2MQCh. 11.12 - Prob. 3MQCh. 11.13 - Prob. 1MQCh. 11.13 - Give an example of a genetically modified plant...Ch. 11.13 - How have transgenic salmon been engineered to...Ch. 11.14 - Explain why recombinant vaccines might be safer...Ch. 11.14 - Prob. 2MQCh. 11.15 - Explain why metagenomic cloning gives large...Ch. 11.15 - Prob. 2MQCh. 11.16 - Prob. 1MQCh. 11.16 - Prob. 2MQCh. 11.17 - What are biobricks?Ch. 11.17 - How was Escherichia coli modified to produce a...Ch. 11 - Prob. 1RQCh. 11 - Prob. 2RQCh. 11 - Describe the basic principles of gene...Ch. 11 - Prob. 4RQCh. 11 - Prob. 5RQCh. 11 - Prob. 6RQCh. 11 - Prob. 7RQCh. 11 - REVIEW QUESTIONS 8. What is a reporter gene?...Ch. 11 - Prob. 9RQCh. 11 - Prob. 10RQCh. 11 - Prob. 11RQCh. 11 - Prob. 12RQCh. 11 - Prob. 13RQCh. 11 - Prob. 14RQCh. 11 - Prob. 15RQCh. 11 - Prob. 16RQCh. 11 - Prob. 17RQCh. 11 - What is the Ti plasmid and how has it been of use...Ch. 11 - What is a subunit vaccine and why are subunit...Ch. 11 - How has metagenomics been used to find novel...Ch. 11 - Prob. 21RQCh. 11 - Prob. 22RQCh. 11 - Prob. 1AQCh. 11 - Suppose you have just determined the DNA base...Ch. 11 - Prob. 3AQCh. 11 - Prob. 4AQ
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY