Brock Biology of Microorganisms (14th Edition)
14th Edition
ISBN: 9780321897398
Author: Michael T. Madigan, John M. Martinko, Kelly S. Bender, Daniel H. Buckley, David A. Stahl, Thomas Brock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 11, Problem 2AQ
Suppose you have just determined the DNA base sequence for an especially strong promoter In Escherichia coli and you are Interested in incorporating this sequence into an expression vector. Describe the steps you would use. What precautions are necessary to be sure that this promoter actually works as expected in its new location?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Arrange the steps that would be used in a laboratory to engineer a bacterium that could express the human gene coding for factor VIII. (Not all steps will be placed).
You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience.
From this experiment you can conclude that:
Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon).
True or false:
Spacer
(a)
-10 region
-35 region
TTGACA
Consensus sequence
TATAAT
Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT
Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT
Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT
Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT
(b)
700
600-
500-
400-
300-
200-
100.
0
● True
O False
B-Galactosidase activity
Wild-type…
In bacteria, genes that are often used together are controlled by a single promoter. Explain why this is the case.
Chapter 11 Solutions
Brock Biology of Microorganisms (14th Edition)
Ch. 11.1 - Prob. 1MQCh. 11.1 - Prob. 2MQCh. 11.2 - Prob. 1MQCh. 11.2 - Prob. 2MQCh. 11.3 - Why is a primer needed at each end of the DNA...Ch. 11.3 - MINIQUIZ
• From which organisms are thermostable...Ch. 11.3 - How does RT-PCR differ from traditional PCR?Ch. 11.4 - What is the purpose of molecular cloning?Ch. 11.4 - Prob. 2MQCh. 11.4 - Prob. 3MQ
Ch. 11.5 - Prob. 1MQCh. 11.5 - How can site-directed mutagenesis be useful to...Ch. 11.5 - What are knockout mutations?Ch. 11.6 - Prob. 1MQCh. 11.6 - Prob. 2MQCh. 11.7 - Prob. 1MQCh. 11.7 - Prob. 2MQCh. 11.7 - Prob. 3MQCh. 11.8 - Prob. 1MQCh. 11.8 - Prob. 2MQCh. 11.9 - MINIQUIZ
• Describe the components needed for an...Ch. 11.9 - Prob. 2MQCh. 11.10 - Prob. 1MQCh. 11.10 - Prob. 2MQCh. 11.10 - Prob. 3MQCh. 11.11 - What major advantage does cloning mammalian genes...Ch. 11.11 - Prob. 2MQCh. 11.12 - Prob. 1MQCh. 11.12 - Prob. 2MQCh. 11.12 - Prob. 3MQCh. 11.13 - Prob. 1MQCh. 11.13 - Give an example of a genetically modified plant...Ch. 11.13 - How have transgenic salmon been engineered to...Ch. 11.14 - Explain why recombinant vaccines might be safer...Ch. 11.14 - Prob. 2MQCh. 11.15 - Explain why metagenomic cloning gives large...Ch. 11.15 - Prob. 2MQCh. 11.16 - Prob. 1MQCh. 11.16 - Prob. 2MQCh. 11.17 - What are biobricks?Ch. 11.17 - How was Escherichia coli modified to produce a...Ch. 11 - Prob. 1RQCh. 11 - Prob. 2RQCh. 11 - Describe the basic principles of gene...Ch. 11 - Prob. 4RQCh. 11 - Prob. 5RQCh. 11 - Prob. 6RQCh. 11 - Prob. 7RQCh. 11 - REVIEW QUESTIONS
8. What is a reporter gene?...Ch. 11 - Prob. 9RQCh. 11 - Prob. 10RQCh. 11 - Prob. 11RQCh. 11 - Prob. 12RQCh. 11 - Prob. 13RQCh. 11 - Prob. 14RQCh. 11 - Prob. 15RQCh. 11 - Prob. 16RQCh. 11 - Prob. 17RQCh. 11 - What is the Ti plasmid and how has it been of use...Ch. 11 - What is a subunit vaccine and why are subunit...Ch. 11 - How has metagenomics been used to find novel...Ch. 11 - Prob. 21RQCh. 11 - Prob. 22RQCh. 11 - Prob. 1AQCh. 11 - Suppose you have just determined the DNA base...Ch. 11 - Prob. 3AQCh. 11 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…arrow_forwardAfter cloning is carried out to insert a foreign gene into BL21(DE3), you would like to confirm the expression of the foreign protein in the bacteria using a blotting technique. Briefly describe the steps to achieve your objective with simple illustrations and descriptions.arrow_forwardHelp me pleasearrow_forward
- Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.arrow_forwardSuppose you had isolated a new transcription factor and wanted to know which genes this protein might regulate. Is there any way that you could use a cDNA microarray of the type shown in the picture to approach this question?arrow_forwardThe streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1arrow_forward
- B onlyarrow_forwardPlease express the following in detailarrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the lowest beta-galactosidase enzyme activity, when grown in the lactose medium. Orpt o* z* r* Orpt ot z* Y OrptoztY Orrotzr OrPotz*Yarrow_forward
- answer c onlyarrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forwardArrange the steps that would be used in a laboratory to engineer a bacterium that could express the human gene coding for factor VIII. Not all steps will be placed. Isolate the human gene that produces factor VIII. Isolate the mRNA of the factor VIII gene. Generate cDNA of the factor VIII gene using reverse transcriptase. Incorrect Insert the factor VIII cDNA into a bacterial vector near a promoter site. Transform the vector into an E. coli bacterium. Human DNA is introduced into the bacterial cell using direct injection by a small needle. E. coli expresses factor VIII. Answer Bank The factor VIII protein is isolated from human tissues.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY