1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many c
Q: The genetic map below shows the location of three genes on a chromosome. Order the gene pairs based…
A: Gene mapping is the sequential allocation of loci to a relative location on a chromosome. Genetic…
Q: Why was the location of the Ebola outbreak so catastrophic? A. Because it began on the border of 3…
A: The question is asking why the location of the Ebola outbreak was so catastrophic. The Ebola…
Q: 7. Define cephalization. What is its relationship to bilateral symmetry?
A: Question-7. Cephalization refers to the evolutionary trend in which animals exhibit an increased…
Q: Match each organelle with its corresponding structure/function. [Each choice will be used exactly…
A: The objective of the question is to match each organelle with its corresponding structure or…
Q: When blood sugar is ________ the islets of Langerhans release ________ in order to tell the cells of…
A: The correct answer is option 4) High; Insulin. Whеn blood sugar is high, thе islеts of Langеrhans…
Q: According to the video, What is the pigment in our skin that reflects or absorbs light? Video -…
A: Skin color is a key human phenotypic characteristic and is impacted by a few components, one of…
Q: According to the video “The Biology of Skin Color”, skin color is associated with other aspects of…
A: The question is asking whether skin color, according to the video 'The Biology of Skin Color', is…
Q: 1. List the three major types of community interactions. 2. Describe the relationship between a…
A: Note:- Sorry, since you have posted multiple questions, as per the honor code we are solving the…
Q: 7. Identify and define two processes by which water naturally changes from a solid or liquid to a…
A: In the realm of natural phenomena, water exhibits a captivating metamorphosis, seamlessly…
Q: According to the video “The Biology of Skin Color”, why is it that the allele coding for darker skin…
A: One kind of cancer that starts in the skin's cells is called skin cancer. It happens when skin cells…
Q: Which of the following are shared by both plants and animal cells? [Select any/all that apply.]…
A: The objective of this question is to identify the cellular components that are common to both plant…
Q: Vertebrate Group Fishes Amphibians Reptiles Avians Mammals Adenohypophysis Neurohypophysis Thyroid…
A: Hormones are the chemical substances that are secreted by specialised glands called endocrine…
Q: The ____ and ____ are both found deep within fissures of the cerebral cortex. These two regions form…
A: The question is asking to identify the two regions of the brain that are found deep within the…
Q: When light strikes a photoreceptor, it reduces the amount of glutamate that it releases. This…
A: The question is asking about the sequence of events that occur in the eye when light strikes a…
Q: In the 1930's a chemical known as DNP was touted as en effective diet pill. Weight loss was dramatic…
A: The question is asking about the effect of DNP (2,4-Dinitrophenol), a chemical that was used as a…
Q: What symptom began to increase in the Brazilian population that started to cause concern among…
A: The question is asking about a specific health concern that began to increase in the Brazilian…
Q: Why do viruses need to infect a host? A. In order to eat other viruses B. In order…
A: The objective of the question is to understand why viruses need to infect a host organism.
Q: Why is it important to remember that gender cannot be identified from human remains? A. Because…
A: Sex and gender are interchangeable terms used commonly in the society. Sometimes they may be same…
Q: Which of the following statements does NOT agree with the cell theory? Singled-celled Amoeba arise…
A: The objective of the question is to identify the statement that does not align with the cell theory.…
Q: Hormonal control among invertebrates. Complete the table Invertebrates Endocrine Structures…
A: There are a few important points about animalia:Animals are multicellular eukaryotes with…
Q: Mrs. Anderson, a 45-year-old woman with a history of chronic back pain, has been taking X as…
A: An appropriate approach to explore the potential hepatotoxicity linked to drug X is to opt for a…
Q: The dietary technique designed to increase the glycogen content in both the liver and muscles in an…
A: Glycogen is a type of carbohydrate that is stored in the muscles and liver of animals and humans. It…
Q: According to the video “The Biology of Skin Color”, why are UV rays dangerous to our bodies? What…
A: The question is asking about the harmful effects of UV rays on our bodies. UV rays, or ultraviolet…
Q: What caused the change in health during the Neolithic period? A. The development of agriculture B.…
A: The Neolithic period, also known as the New Stone Age, was a time of significant change in human…
Q: What are diseases that come from animals called? A. Zoonotic B. Non-human-notic…
A: The objective of the question is to identify the correct term for diseases that are transmitted from…
Q: What happens with a 50/50 split bewteen glucose and lactose in the lac operon? in the lac operon the…
A: The lac operon is a set of genes that are used in the metabolism of lactose in E. coli. The genes in…
Q: Two closely-related species overlap at the southern edge of the range for species A, and the…
A: A niche includes all of the interactions of a species with the other members of its community. When…
Q: You have sampled a population in which you know that the percentage of the homozygous recessive…
A: The Hardy-Weinberg equilibrium is defined as a population genetics principle which defines the…
Q: A young man presents with a blood pressure of 175/110 mm Hg. He is found to have a high circulating…
A: The male subject in the case seen to have elevated blood pressure, increased levels of circulating…
Q: Why is the Nipah virus a great illustration of a zoonotic disease? A. Because it's carried by fruit…
A: The objective of the question is to understand why the Nipah virus is a good example of a zoonotic…
Q: Do you think Medicaid and Medicare are Social Insurance or more of Public Assitance programs?
A: The question is asking to categorize Medicaid and Medicare, two major health care programs in the…
Q: What does it mean that excavation is a destructive process? A. As a site is excavated, it is…
A: The question is asking about the nature of archaeological excavation and why it is often referred to…
Q: Ribulose bisphosphate carboxylase, which might be the most abundant protein on Earth, is part of…
A: The question is asking about the role of Ribulose bisphosphate carboxylase, also known as RuBisCO,…
Q: For the following structures, indicate if they arose once, perhaps twice or several times. a)…
A: Important biological structures have evolutionary origins that raise the question of whether these…
Q: What is an example of evolutionary mismatch in modern day humans? A. Fruits and vegetables were…
A: The concept of evolutionary mismatch refers to the idea that certain traits or behaviors that were…
Q: Race is a socially or self-ascribed category. True False
A: The concept of race is a complex one that has both biological and social dimensions. From a…
Q: How is the Zika virus spread? A. Through person-to-person contact B. Through…
A: The objective of the question is to understand the mode of transmission of the Zika virus.
Q: Humans do not exhibit a lot of physical variation in their skeletons. True False
A: The objective of the question is to determine whether there is a significant amount of physical…
Q: According to the video “The Biology of Skin Color”, skin color is associated with other aspects of…
A: Skin colour shows large variability among different individuals ranging from very dark to light…
Q: You are studying the effects of a newly developed enzyme in different temperate climates and want to…
A: Enzyme activity:- It is the rate at which an enzyme catalyzes the reaction.
Q: If you sit at your window and watch a car driving away from you, the ... stream of your visual…
A: The question is asking about the two visual streams in the human brain that process different…
Q: Why does digestion need regulation and how is it achieved?
A: The process of breaking down complex dietary ingredients into more absorbable, simpler forms that…
Q: trace minerals... A) are found in large quantities in most processed foods B) have physiological…
A: Trace minerals, also known as trace elements or micro minerals, are essential minerals that the…
Q: If glucose is labeled with radioactive Carbon 14, what molecule(s) will become radioactive after…
A: Through the production of ATP, a molecular energy source, the glucose metabolism supplies the energy…
Q: he main benefit of a three-dimensional culture system is that: O the morphology and behavior of…
A: In the realm of biological sciences, three-dimensional (3D) cell culture systems represent…
Q: Which of the following statements is NOT true about the sensory systems? Chemoreceptors are…
A: The sensory system is a part of the nervous system responsible for processing sensory information. A…
Q: What are the hormones involved and the role they played in the urine formation?
A: The chemical messengers in the human body are known by this name, hormones. Ductless glands secrete…
Q: Table 2 This table is for gathering data on the effects of temperature, light, or seed type on…
A: The objective of this question is to create a graph that compares the rate of respiration of…
Q: which of the following amino acids is considered an essential amino acid? a) serine b) alanine…
A: Amino acids are organic compounds that combine to form proteins. They are classified into two…
Q: 11. Show that the degradation of a saturated C12 fatty acid will yield more energy (ATP) than the…
A: The degradation of greasy acids and glucose through metabolic pathways could be a principal process…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Shown below is a schematic diagram illustrating a very short gene with 5000 bp region of an unknown Schizosaccharomyces pombe genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5. 3' 3 +1 (i) Name the specific regions that can be recognized by Transcription Factor IID (TF ID) and indicate the locations in the diagram above. (ii) List the mechanistic steps that can trigger the initiation of transcription by Transcription Factor IIH (TF IIH).Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
- Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been associated with many types ofcancers. For this reason, researchers would like to develop drugs toinhibit oncogenic rasH. Based on your understanding of the Rasprotein, what types of drugs might you develop? In other words,what would be the structure of the drugs, and how would theyinhibit Ras protein? How would you test the efficacy of the drugs?What might be some side effects?Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
- The sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).Which of the following statements is/are TRUE for the promoters? The Pribnow box and TATA box are found in the prokaryotes and eukaryotes, respectively. For both prokaryotes and eukaryotes, the first ribonucleotide attaches to the TSS region. The -35 element in prokaryotes is called the Up element in eukaryotes. In prokaryotes, the Pribnow box is located 25 bases before TSS.
- You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'Termicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…Describe how transcription would be affected in the Galactose metabolizing pathway in Yeast in the presence of the following mutations. 1. A mutation that resulted in an inability of Gal80 to enter the nucleus. 2. A mutation that resulted in a lack of ability of Gal3 to bind galactose.