9. In eukaryotic gene expression, non-coding RNAS such as miRNA (microRNA important role in gene regulation. That role is to ... A) bind to target mRNA to prevent translation B) bind to target mRNA to prevent transcription C) block RNA polymerase from reaching the promoter D) increase levels of chromatin packing

9. In eukaryotic gene expression, non-coding RNAS such as miRNA (microRNA important role in gene regulation. That role is to ... A) bind to target mRNA to prevent translation B) bind to target mRNA to prevent transcription C) block RNA polymerase from reaching the promoter D) increase levels of chromatin packing

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

19
3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination to regulate gene expression?
2b) Once an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription?
What is one function of TFIIH during transcription? a. Recruiting the TATA-box binding protein to the TATA-box. b. Terminating transcription via factor-dependent termination. c. Capping the 5' end of mRNA with 7-methylguanylate. d. Phosphorylating the CTD of RNA polymerase.
Describe three types of post-transcriptional regulation of protein coding genes.
36. What are the three major types of regulatory RNAs and what is their overall function? A. microRNAs, Small interfering RNAs, long noncoding RNAs- control the expression of thousands of genes B. microRNAs, mRNAs, small interfering RNAs- control the expression of thousands of genes C. rRNAs, tRNAs, microRNAs- control the expression of a few genes D. microRNAs, Small interfering RNAs, long noncoding RNAs- control the expression of a few genes E. None of the above
-Gene transcription/translation (circle one) is more complex than Gene transcription/translation (circle one) because_________________________________. -What is the difference between the “regulatory region”/origin and the “transcribed region”/code? - “ALL DNA codes for proteins.” Is it true or false? Why or why not? Claim- Evidence- Reasoning - Explains the sequence of how DNA codes for protein.
In considering the 7 levels of gene regulation, which of the following mechanisms acts at first level? a. repressor binding to sequence blocking the promoter b. miRNA silencing c. differential processing of RNA d. protein modification e. answer may vary depending if this occurs in a prokaryote or a eukaryote
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
Describe 3 ways by which transcription could be regulated (Hint 3 methods/tools/mechanisms that a cell can use to increase or decrease the amount of transcription, hint: Using a 1..... 2..... 3.....no part marks) A/
1. Draw a simplified model of a cis-regulatory element with multiple trans-acting factors up-regulating gene expression. Your simplified model must include: a double-stranded DNA molecule labeled with its appropriate orientation (3' and 5', etc.), an area of DNA highlighting the gene of interest to be transcribed, a highlighted area showing the promoter region, one cis-regulatory element upstream of the promoter with its specific transcription factor • RNApol + a general transcription factor + a TATA binding protein all bound to the appropriate area (think about where these bind before transcription starts), an upstream enhancer with its transcription factor bound to it, • and finally the TSS. All parts must be labeled and in the correct area to earn full credit. **I suggest using different colors for this drawing problem**.
In eukaryotes, chromatin remodeling plays an important role is gene regulation. This is because a. repositioning of the nucleosomes makes DNA accessible to transcription regulatory proteins b. the nucleosomes contain important regulatory regions c. chromatin remodeling activates gene expression d. chromatin remodeling represses gene expression