1. Draw a simplified model of a cis-regulatory element with multiple trans-acting factors up-regulating gene expression. Your simplified model must include: a double-stranded DNA molecule labeled with its appropriate orientation (3' and 5', etc.), an area of DNA highlighting the gene of interest to be transcribed, a highlighted area showing the promoter region, one cis-regulatory element upstream of the promoter with its specific transcription factor • RNApol + a general transcription factor + a TATA binding protein all bound to the appropriate area (think about where these bind before transcription starts), an upstream enhancer with its transcription factor bound to it, ally the TSS. and All parts must be labeled and in the correct area to earn full credit. **I suggest using different colors for this drawing problem**.

Q: RNAi...  result in product of dsrna or sirna to sirna or mirna! does it increase or decrease…

A: RNA i or RNA interference is a natural process occurs; in most of the eukaryotes;post…

Q: promoters Insulators are particular that control access of enhancers to translation transcription…

A: Introduction  Gene expression is the process through which information from a gene is used to create…

Q: The amount of this in the cell rises as DNA synthesis begins. Cis-acting element that can increase…

A: Step 1: Step 2:Step 3: Step 4:

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: Describe the ways in which gene expression is regulated Must include: • Transcription factors •…

A: Transcription factors and Histone acetylation favors gene expression and DNA methylation represses…

Q: Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you…

A: CI represses cro and Cro represses cI. This is referred to as the double-negative feedback loop and…

Q: How does the GA(T>C)A mutation in the Duffy promoter impact Duffy transcription? GACA enhancer does…

A: Duffy is a gene which expresses a protein called duffy protein. This protein act as membrane bound…

Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…

A: The eukaryotic genome is huge and consists of millions of base pairs. It is highly packed in…

Q: In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m…

A: Transcription of genes includes the formation of RNA using the template DNA. It includes the enzyme…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific…

A: Transcription factors are proteins that bind to neighbouring DNA and help switch particular genes…

Q: In the presence of excess tryptophan, a repressor protein binds the operator of the trp operon and…

A: positive gene regulation in the presence of lactose and low glucose , the lac operon is expressed 20…

Q: Complete the table to figure out if transcription is happening or not.   Glucose Lactose LacI…

A: Operons are a combination of genes that function together to regulate the transcription of…

Q: 2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression

A: Gene expression is the process by which a particular or a set of genes are expressed with the help…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Identify the levels at which gene expression can be regulated in prokaryotes and eukaryot Which of…

A: The gene is a sequence of nucleotides that encode a specific protein. The gene expression is…

Q: Based on my your observations, describe the role of the transcription factors and the regulatory…

A: Central dogma involves a method where RNA formed from DNA , and DNA shows heterocatalytic neture,…

Q: The nr2f5 gene is transcribed into mRNA in both neurons and glia. The microRNA miR-5xb has partial…

A: Introduction  The expression of genes is highly regulated in both prokaryotes as well as in…

Q: The extent to which a given gene is transcribe depends on 1. the particular combination of…

A: Introduction: The biological process involving the copying of the information present in the strand…

Q: Can one transcription factor sometimes act as a repressor and sometimes act as an activator? O a.…

A: We are authorized to answer only one question at a time, since you have not mentioned which question…

Q: 3.) How do cis-acting regulatory elements and trans-acting regulatory proteins act in coordination…

A: A trans-acting element is usually a DNA sequence that contains a gene. This gene encodes for a…

Q: Select all that is true about transcription in eukaryotes. 1.Introns get spliced out of pre-mRNA…

A: Ans- All are true, except Transcription occurs simultaneously and in the same place as translation.

Q: 18. Two eukaryotic genes (A and B) are involved in two different metabolic pathways, and each has a…

A: The segment of a DNA that undergoes transcription (produce RNA) is known as a gene. In case of…

Q: Describe 3 ways by which transcription could be regulated (Hint 3 methods/tools/mechanisms that a…

A: ANSWER;- In prokaryotes, genes are available in bunches as groups. The lac operon qualities encode…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.