Complete the table to figure out if transcription is happening or not.   Glucose Lactose LacI bound to operator (Y/N) CAMP Present (Y/N) CAP bound to promoter (Y/N) RNAP can bind promoter (Y/N) lacZ, lacY, lacA expressed (Y/N) Present Present           Present Absent           Absent Present           Absent Absent

Q: promoters Insulators are particular that control access of enhancers to translation transcription…

A: Introduction  Gene expression is the process through which information from a gene is used to create…

Q: Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect…

A: The mutation is the change in the nucleotide sequence of the DNA. The point mutation is the mutation…

Q: Describe transcriptional components in E. coli for each step of transcription, explain each subunit…

A: In Prokaryotes the process of translation is not complex as the Transcription and Translation both…

Q: Replacement of histones with variant histones will cause an increase in the compaction of the gell…

A: Answer: Histone : These are the Octameric proteins around which DNA winds to form a structural unit…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…

A: An operon is a single transcription unit that can include many genes that code for different…

Q: EUKARYOTIC RNA POLYMERASE TRANSCRIPTION FACTORS Rather than just a sigma factor to recognize the…

A: Answer ::   RNA polymerase  extend or polymerise RNA.  Sigma subunit of RNA polymerase binds to…

Q: In order to identify cis-regulatory elements for the BRC2 gene in Arabidopsis thaliana, you develop…

A: The region of non coding DNA that play a critical role in gene expression regulation is known as cis…

Q: Search about transcription elongation factor P-TEFb with its relationship with CDK9 and RNA Pol II,…

A: As the question contains an external link, according to the guidelines, external links can not be…

Q: Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you…

A: CI represses cro and Cro represses cI. This is referred to as the double-negative feedback loop and…

Q: How does the GA(T>C)A mutation in the Duffy promoter impact Duffy transcription? GACA enhancer does…

A: Duffy is a gene which expresses a protein called duffy protein. This protein act as membrane bound…

Q: Enhancers in eukaryotic genomes such as glucocorticoid response elements can upregulate multiple…

A: An Enhancer in Eukaryotic genomes is defined as the DNA sequence which promotes the transcription.…

Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…

A: The eukaryotic genome is huge and consists of millions of base pairs. It is highly packed in…

Q: In a couple of sentences, explain how eukaryotic activator proteins (that are usually gene-specific…

A: Transcription factors are proteins that bind to neighbouring DNA and help switch particular genes…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: 15.3 Explain the fellovine diaeram: prospective nuclear protein nuclear Ran HYDROLYZES ITS BOUND…

A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…

Q: Which of the following is true for gene regulation in both bacteria and eukaryotes? Selected answer…

A: Gene regulation refers to the act of activating and deactivating genes. Cells start to perform…

Q: RNAP can access the lacZ promoter irrespective of whether CAP-CAMP is binding the CAP o True False

A: Lac operon is a set of structural genes regulated by a common promoter. It is found in bacteria.

Q: Select all of the regulators of transcription that bind to DNA when an allosteric effector (inducer…

A: The regulators of transcription that bind to DNA when an allosteric effector is present. Allosteric…

Q: 20. You are modelling a genetic circuit shown above on Simbiology. What would the Reaction Rate…

A: Simbiology is a software application that is used to model and simulate biological systems,…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…