S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase is likely to be a [Select] Protein X is a transcription factor that normally activates the expression of genes needed for S- phase. The activator of protein X is likely to be a [Select]

Q: The GA(T>C)A mutation in the Duffy promoter impacted expression of Duffy in the following cell…

A: The promoter is the region where the RNA polymerase binds during the transcription i.e. synthesis of…

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…

A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…

Q: List one example of AMPLIFICATION OF SIGNAL during the cell’s response to Hedgehog

A: * Hedgehog signalling pathway is important during embryogenesis to  controll proliferation of tissue…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…

Q: You are a scientist studying two related congenital diseases, Noonan syndrome and Tiger syndrome.…

A: We will solve the first question for you. If you want any specific question to be solved then please…

Q: What happens in the patched-smoothened signaling system if the hedgehog is NOT present?  A. In the…

A: A gene is a genetic molecule that is passed down from one generation (parents) to the next…

Q: In a normal cell, micro-RNA (mIR-433) acts to regulate ras - what would happen to a cell if there…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Indicate whether the protein binds directly or indirectly (assuming it does) to DNA and whether to…

A: Introduction :- DNA acts the genetic material of the cell because it have all the genetic…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: What is the difference in time between signaling pathways that affect protein function vs. pathways…

A: Cells respond to the external environment or stimulus by activating a signaling pathway. It leads to…

Q: What areas of the brain do you think are affected when there is a decreased expression of ERα mRNA…

A: * The estradiol is the harmone which will do protection actions. *This will help effects the long…

Q: GC (Glycocorticoids) binds to the glucocorticoid receptor (GR), which leads to the transcription of…

A: Receptors are structures made of proteins that transduce signals in the cells upon binding of the…

Q: Ras activation can activate O MAP kinase O Protein kinase B Phospholipase C O Two of the above O All…

A: Ras, a tiny GTP-binding protein, is a key component of the signal transduction pathway that growth…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the formation of protein from the mRNA in the cytoplasm.

Q: mediated signaling without ligand, suggesting the signaling pathway has been constitutively…

A: Receptor tyrosine kinase is involved is cell signal transduction by a ligand it is responsible for…

Q: Which of the following mutations in a gene encoding a transmembrane receptor protein is most likely…

A: "Analyzing mutations in a gene encoding a transmembrane receptor protein, we investigate the…

Q: Describe how you would experimentally demonstrate that a specific G beta protein subunit is required…

A: Cells communicate with each other via released proteins unique to each kind. Signal transduction…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.