After further investigation, you discovered that HHT1 and HHT2 are produced via alternative splicing. HHT1 is expressed in the liver, and  HHT2 is expressed in the pancreas. Regarding the regulation of their expression, you conclude: all answers are possible the regulation occurs at the epigenetic level the regulation occurs at the transcriptional level the regulation occurs at the level of splicing

Q: What would be the likely phenotypic effect of a mutation in HOTAIR and prevented it from binding to…

A: HOTAIR (HOX antisense intergenic RNA) is a long non-coding RNAs with 6 exons and 2158 nucleotides…

Q: How regulatory protein can regulate/inhibit the gene expression?  Please explain at your own words.

A: The gene expression is the production of RNA from DNA or gene by the process called transcription.…

Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'

A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…

Q: What epigenetic modification(s) would you expect to see near a gene promoter where transcription is…

A: The histones undergo methylation and acetylation for close and loose packaging of the DNA. The…

Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…

A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…

Q: List and briefly describe five types of molecular mechanisms thatmay underlie epigenetic gene…

A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…

Q: Regulation of transcription is mediated by proteins that first must bind to specific…

A: Hi dear,here is your answer. Gene expression is defined as the process by which the information that…

Q: Give the result(s) of the experiment in "MicroRNAs Control De Novo DNA Methylation Through…

A: INTRODUCTION MicroRNAs (miRNAs) are a class of small, single-stranded non-coding RNAs that regulate…

Q: How does RNA regulate gene expression? Specifically what is the pathway siRNA and miRNAs regulate…

A: The genes are expressed when the genetic codes of the DNA are fully converted into the protein…

Q: Which of the following is NOT a property of general tra ripion O Each eukaryotic gene utilizes a…

A: Transcription factors are proteins that play a crucial role in regulating gene expression. They bind…

Q: How do we know that expression of the information encoded in DNA involves an RNA intermediate?

A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various genes…

Q: The Lac operon is a common example of prokaryotic control of gene expression. In what condition is…

A: Lac operon consists of structural genes such as lacZ, lacY, and lacA which are responsible for the…

Q: Define the epigenetic mechanisms - regulation of gene expression by noncoding RNA molecules ?

A: Epigenetics is the study of inherited changes in phenotype (appearance) or gene expression that are…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Enhancers contain binding sites for transcription factors that regulate transcription. are…

A: Enhancers  Enhancers are found in the upstream of DNA. They are short sequence about 50 to 1500 base…

Q: Consider the CT/CGRP example of alternative splicing. Which different types of alternative splicing…

A: Alternative splicing is a technique that allows messenger RNA (mRNA) to control the production of…

Q: Formation of a GC-rich stem-loop in the mRNA is required for function of an intrinsic transcription…

A: Transcription is the process in which mRNA corresponding to a gene is synthesized by RNA Polymerase.…

Q: In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the…

A: When RNA polymerase binds to a DNA molecule, transcription can begin. This binding takes place at…

Q: eukaryotic cells, which of the following is typical of how transcription is regulated? Group of…

A: A regulatory gene is a gene involved in controlling expression of one or more genes . It can…

Q: Which of the following specific examples of gene expression control is incorrectly matched?

A: Answer: GENE EXPRESSION = It is a process by which an information from a gene is used to synthesize…

Q: The choice between lysogeny and lysis is influenced by many factors. How would external conditions…

A: The viral reproduction process refers to the formation of viruses while infecting the target host…

Q: Organisms must rapidly acclimate to changes in their environment. For instance, temperature changes…

A: Octopus bimaculoides often called "bimac" is an octopus species that belongs to class cephalopoda.…

Q: Describe ways to achieve post-transcriptional control of gene expression

A: Transcription is the process in which RNA is transcribed with the help of the DNA template. In the…

Q: A translocation mutation results in a silencer being inserted just upstream of the promoter of a…

A: When a repressor protein binds to the silencer region of DNA,  polymerase is prevented from…

Q: This type of negative feedback loop ensures that ilvC transcription will always be repressed when…

A: Hi! Since you posted many questions, we will be answering the 1 for you. Please post the other…