You continue to study the expression of the hexose kinase gene and capture the following electronmicrograph of the gene being expressed.MRNA120ORI4060TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATCAAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG5"3'RNApromoterpolymerase4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How doyou know?4b. What is the sequence of the first 10 nucleotides of the transcript of this gene?5'3'---4c. What are the first 5 amino acids encoded by this gene?)Note - there is a codon tableavailable at the beginning of this exam.N'C'4d. Will translation stop at the UAA which begins at position 41? Explain your logic4e. You also study the expression of 3 different mutants for this gene. For each mutant answer thefollowing:Does this mutation change the sequence of the protein produced? Why or why not?If it does change the sequence of protein be sure to write out the new sequence.o If it does not change the protein sequence, what effect (if any) would you expect itto have on expression of the gene?120ORI40605'.TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTAT.3'3'...АAGCTCGAGAGCAGCAGCTCТАТСCGCTАСТАТААTGACCATTAТАССССТАСGTGATAG..5'promoteri. Mutant A has a single base pair substitution with the TIA being replaced with C/G base pair atposition 35 (position denoted by the * in the sequence above).ii. Mutant B has a 2 GIC pairs inserted between position 19 and 20 (position denoted by the ^ inthe sequence above).ii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change thesequence of the protein produced? Why or why not? If it does change the sequence of proteinbe sure to write out the new sequence. If it does not change the protein sequence, what effect(if any) would you expect it to have on expression of the gene?ribosome

Name: You continue to study the expression of the hexose kinase gene and ca
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You continue to study the expression of the hexose kinase gene and capture the following electronmicrograph of the gene being expressed.MRNA120ORI4060TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATCAAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAС