Refer to the following illustration to answer the question. O protein A is not made because it is normally required for its own transcription TRANSIENT SIGNAL TURNS ON EXPRESSION OF PROTEIN A What is protein A? O a maintenance methyltransferase O a histone PAY O a cell type-specific gene regulator a HAT (histone acetyltransferase) any of the above PAD the effect of the transient signal is remembered in all of the cell's descendants

Q: he Drosophila oocyte/embryos A-F show the expression patterns of various mRNAs.  Which is the…

A: Fruit flies, or Drosophila melanogaster, have led to significant research as model organisms in…

Q: Match the mutation in the trpL leader sequence with the correct phenotype of the mutant. A. The TRP…

A: Introduction The trp operon is a collection of genes found in E. coli bacteria that code for…

Q: st noncoding RNA (ncRNA) triggers X inactivation by coating the X chromosome that produces it and by…

A: Xist is a long non-coding RNA on the X chromosome. Xist acronym is X -inactive-specific transcript…

Q: In all mammals, insulin growth factor 2 is expressed from only the allele that is inherited by one's…

A: Igf2 stands for insulin growth factor 2. It is responsible for maintaining the growth in the tissue…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: Select the answer that correctly expresses a valid comparison between transcriptional regulation in…

A: Transcriptional regulation is far more complex in eukaryotes than in prokaryotes. Prokaryotic…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…

Q: A region of a eukaryotic chromosome that is gene-rich (i.e. contains many genes) would be expected…

A: The presence of a membrane-bound nucleus is the primary feature that distinguishes a eukaryotic cell…

Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…

A: The eukaryotic genome is huge and consists of millions of base pairs. It is highly packed in…

Q: tatement about the HATS is FALSE? do not interact with non-pioneer regulatory transcription facto…

A: HATs : Histone acetyl transferases. These are the enzymes that acetylate conserved lysine residuals…

Q: Enzymes that acetylate the ε-amino group of lysine in the histone tails are called ____ and are…

A: Histones are protein molecules present in nucleosome core of the chromatin material around the…

Q: Discuss the role of chromatin and modification of chromatin structure in controlling eukaryotic gene…

A: The mechanism of encoding of proteins by a gene which regulates cellular functions is known as gene…

Q: You gather the following data on the expression of a eukaryotic gene which experiences positive gene…

A: Eukaryotic gene expression are mainly regulated at 4 stages ; Transcription level: gene product is…

Q: Propose a model that outlines, step-by-step, events that could reasonably generate the expression of…

A: The "Eve stripe protein" refers to a specific protein called "Even-skipped" (Eve) that is involved…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Eviction of histones will cause adecrease in the compaction of the genomic DNA and therefore lead to…

A: The genome in Eukaryotes is huge and is compactly packed within the nucleus. Thus, packing of DNA is…

Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…

A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…

Q: Discuss the control of gene expression in eukaryotes. keep it short plz

A: gene expression: It is a process of transcription of a gene into mRNA, processing of mRNA and…

Q: The transcription factor Pax6 is required continuallyduring the life of a mouse (or a human) for the…

A: Pax6 is a kind of transcription factor which is required for the development of retina in mouse and…

Q: A female honeybee larva becomes worker instead of queen because of: OHDAC (histone deacetylase) O…

A: Introduction Honey bee are of three types adult bees: workers, drones, and a queen. Worker bees help…

Q: W die Capabie transcriptional activation? H2B H3 Н4 All of the above

A: Histones are alkaline (fundamental pH) proteins. They are found inside the nucleus of eukaryotic…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.