You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 3' ТТCGAGCTCTССTCGTCGAGATАCGCGATGATAТТАСTGGIAATАТСGGGATGCAСТАТС ACTATC AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇCCCTACGTGATAG 5' promoter RNA polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3 ...TТCGAGCТСТСGТCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC..5' 5'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 3' ТТCGAGCTCTССTCGTCGAGATАCGCGATGATAТТАСTGGIAATАТСGGGATGCAСТАТС ACTATC AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇCCCTACGTGATAG 5' promoter RNA polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3 ...TТCGAGCТСТСGТCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC..5' 5'...AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

Name: You study the expression of the hexose kinase gene and capture the fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You study the expression of the hexose kinase gene and capture the following electron micrograph ofthe gene being expressed.MRNA120ORI4060TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA!AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG3'СTGGI

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: A mutation is a change in the sequence of the DNA that may affect the codons of the DNA or mRNA.…

Q: In the figure below, what is represented by the line labeled A? TFIIB recognition element DNA in m…

A: Transcription of genes includes the formation of RNA using the template DNA. It includes the enzyme…

Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…

A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…

Q: Discuss the control of gene expression in eukaryotes. keep it short plz

A: gene expression: It is a process of transcription of a gene into mRNA, processing of mRNA and…

Q: The following truncated sequences are the receptor binding domain of COVID19’s & SARS’ S-protein,…

A: A virus's receptor-binding domain (RBD) is a critical component of the virus's'spike' domain that…

Q: You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance…

A: Cystic fibrosis transmembrane conductance regulator gene is involved in mucus, sweat and digestive…

Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…

A: Translation is the formation of protein from the mRNA in the cytoplasm.

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

You study the expression of the hexose kinase gene and capture the following electron micrograph of
the gene being expressed.
MRNA
1
20
ORI
40
60
TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA!
AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG
3'
СTGGIAATATOGGGATGCACTАТС
5'
RNA
promoter
polymerase
Practice Question 4
F)
You also study the expression of different mutants for this gene.
Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the
sequence above).
For mutant B answer the following:
Does this mutation change the sequence of the protein produced? Why or why not?
If it does change the sequence of protein be sure to write out the new sequence.
If it does not change the protein sequence, what effect (if any) would you expect it
to have on expression of the gene?
1
20
ORI
40
60
3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'
5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3'
promoter
m in
ribosome

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

You are lovely little gene which makes the actin protein (the cytoplasmic cytoskeleton protein). You have just woken up to a transcription factor sitting down on your local TATA box. Tell me all your life events from beginning vou just saw the transcription factors) to end fyour protein death). Don't forget to mention WHERE you have lived during your life, how you have moved, what helped you along the way, and all the other proteins and other small molecules you have
You use a Northern Blot to probe a sample of muscle tissue for a particular MRNA transcript. You detect no MRNA on your blot with this probe. What can you conclude? That this person does not express this gene That this MRNA is not transcribed in this tissue This person does not have the gene that codes for this MRNA Ouestion 10 1 nts 6,680 SEP 33 20 SSE-756 Eq43 Lea X POF MacBook Pro C Q Search or type URL $ & 2 3 4 6 7 9 O E Y U P 00 T LO RC
Match the protein on the left with the type of activation of that protein on the right STAT Smad PKA Ras NFKB Nuclear receptor [Choose] [Choose] GTP binding serine phosphorylation Interaction with Galpha Cleavage by y-secretase destruction of a protein by proteasome tyrosine phosphorylation second messenger ligand binding [Choose] [Choose] [Choose]
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGAТАТТАСТGGТААТАТСGGGАTGCAСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||