You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance regulator) mRNA is expressed in small intestine tissue. You do not detect any MRNA in this sample. Which of the following is a valid conclusion from your experiment? O This gene is not expressed in this organism O This gene is likely not transcribed in the small intestine O Small intestine cells do not contain the CFTR gene O There is no MRNA, because it has all been converted to protein

You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance regulator) mRNA is expressed in small intestine tissue. You do not detect any MRNA in this sample. Which of the following is a valid conclusion from your experiment? O This gene is not expressed in this organism O This gene is likely not transcribed in the small intestine O Small intestine cells do not contain the CFTR gene O There is no MRNA, because it has all been converted to protein

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC AAGCTCGAGAGCAСCAGCTСТАТGCGСТАСТАТААТGAССАКТАТАСССТАCGTGATAG 5" 3' RNA promoter polymerase 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? 4b. What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' --- 4c. What are the first 5 amino acids encoded by this gene? )Note - there is a codon table available at the beginning of this exam. N' C' 4d. Will translation stop at the UAA which begins at position 41? Explain your logic 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new…
Scientists have exploited the siRNA pathway toperform a technique called RNA interference—ameans to knock down the expression of a specificgene without having to make mutations in it. Theidea is to introduce dsRNA corresponding to thetarget gene into an organism; the dsRNA is thenprocessed into an siRNA that leads to the degradation of the target gene’s mRNA. One clever methodfor delivery of the dsRNA to some organisms (thenematode C. elegans, for example) is to feed thembacteria transformed with a recombinant plasmidthat expresses dsRNA.a. Draw a gene construct that, when expressed from aplasmid in bacteria, could be used to knock downby RNA interference the expression of gene X ofC. elegans.b. How can you test if gene X expression is obliterated in worms that have eaten the bacteria transformed with a plasmid containing your construct?c. Do you think that only gene X expression will beaffected in these worms? Explain.
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 AGATACGCGATGATATTACTGCTA AAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАССССТАCGTGATAG 3' TТCGAGCTCTСGTCGTCGAGA ПААТАТСGGGATGCАСТАТ С 5' RNA promoter polymerase Practice Question 4 G) You also study the expression of different mutants for this gene. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? For mutant C answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any)…
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…
The method of Northern blotting is used to determine the amountand size of a particular RNA transcribed in a given cell type.Alternative splicing (discussed in Chapter 14) produces mRNAsof different lengths from the same gene. The Northern blot shownhere was obtained using a DNA probe that is complementary tothe mRNA encoded by a particular gene. The mRNA in lanes 1through 4 was isolated from different cell types, and equal amountsof total cellular mRNA were added to each lane. Explain these results.
Certain hormones, such as epinephrine, can increase the levels ofcAMP within cells. Let’s suppose you pretreat cells with or withoutepinephrine and then prepare a cell extract that contains theCREB protein.You then use an electrophoretic mobility shift assay to analyzethe ability of the CREB protein to bind to a DNA fragmentcontaining a cAMP response element (CRE). Describe what theexpected results would be.
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 20 ORI 40 60 3' ТТCGAGCTCTCСТCGTCGAGATACGCGAT SCGATGATATTAC: ТАСTGGTAATАTоGGGATGCACTAТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCANTATAÇCCCTACGTGATAG ΤΑTC 5' promoter RNA polymerase Practice Question 4 B) What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3' ribosome
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for thefollowing questions?1) Which tube from the three is the most appropriate to use and why? 2) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3- HindIII in the MCS?3) How can you guarantee a high expression of your protein…
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for thefollowing questions?1) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide genefrom the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 whichhas a 5-recognition site and a 3- HindIII in the MCS?
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. q1 : How can you guarantee a high expression of your protein in any expression vector? answer please
You are given 3 tubes of RNA and asked by your supervisor to clone the gene encoding the proinsulinC-peptide that will be used later to produce insulin. The first tube contains purified mRNA isolatedfrom pancreatic β-cells from a patient in a post-absorptive state. The second tube contains purifiedmRNA isolated from pancreatic α-cells from a patient during absorptive state. The third tube containspurified mRNA isolated from pancreatic β-cells from a patient during absorptive state. In not morethan 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for thefollowing questions? ) Describe the primary procedure (key steps no details) that you will follow to clone the C-peptide gene from the RNA above into the only vector you have, a pUC expression vector cut open using EcoR1 which has a 5-recognition site and a 3- HindIII in the MCS?