If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing transcripts that will potentially encode protei 1. the MRNA is found in a bacterial cell. I1. transcription and translation of the mRNA will occur simultaneously. I. the alternative splicing happened in the cytoplasm. IV. different exons from a pre-mRNA will be spliced together. V. the different mRNAS will all have poly-A tails. VI.

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: Alternative splicing a. increases the number of proteins made from one gene b. increases the number…

A: in alternative splicing there is a selection of different types of sites of splicing which can…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the…

A: Mutation results in alteration of a nucleotide sequence of DNA which caused due to the mistake in…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Alternate splicing: A. Reduces mRNA half-life by shortening poly(A) tails B. Disrupts histone…

A: Introduction In Molecular Biology, RNA Splicing Is The Process By Which A Newly Synthesised…

Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…

A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…

Q: Below is a diagram of a gene that is not normally alternatively spliced. All four exons (represented…

A: There are in total four exons. These exons contains coding information, including the start and stop…

Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…

A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…

Q: That ribosomes wouldn’t bind to that gene b. No effect since the promoter doesn't have any coding…

A: Transcription take place when DNA sequence is bounded by various transcription factors that convert…

Q: Give one example of a prokaryotic system of gene expression that is more complicated (during…

A: Gene expression refers to the process by which the information stored in a gene is used to…

Q: Which of the following statements about the mechanism of splicing is correct? 1. A mutation in a 5'…

A: The mRNA that is produced by the process of transcription undergoes a modification process in order…

Q: As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and…

A: The pre-mRNA is formed from the DNA, which is further spliced to form mature mRNA. Splicing refers…

Q: Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of…

A: Option A

Q: 55 __________________ assemble to form a spliceosome, the splicing machine that excises introns. A.…

A: Introduction Transcription is a process where mRNA is produced from DNA. After transcription mRNA…

Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…

A: The protein translation is the process of the formation of proteins from the mRNA formed from the…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…

A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…

Q: Can you explain it?

A: RNA splicing involves removing introns and splicing exons to create the mature mRNA molecule. The…

Q: In eukaryotic organisms, pre-mRNA transcripts are formed and need to be modified in order to create…

A: The process of converting a pre-mRNA transcript into a mature mRNA molecule in eukaryotes involves…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: Eukaryotic mRNAs a. require processing to produce mature mRNAs b. do not require processing to…

A: Answer of the question given below...

Q: principle function of 5 ons of eukaryotic mRNA IS: a. to ensure that all nucleotides are…

A: Transcription is process in which DNA equence is copied to make RNA. Its the first step of gene…

Q: The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b.…

A: initiation factors bind to the repressors to regulate the process of translation  there are three…

Q: The following eukaryotic DNA sequence is a made up gene. It contains a promoter (green), a coding…

A: Most eukaryotic genomes are bigger and more complicated than prokaryotic genomes. Eukaryotic genomes…

Q: The addition of the poly-A tail adds more than 200 units of adenine to the strand of mRNA, yet no…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: When the spliceosome binds to the primary transcript shown above, it can attach Select one: O a. to…

A: During splicing, introns (non-coding regions) are removed and exons (coding regions) are connected…

Q: 43. What did the Meselson-Stahl experiment demonstrate? A. The conservative mechanism of DNA…

A: What does meselson and Stahl experiment demonstrate? Meselson and Stahl experimented using E. coli…

Q: Considering only the listed genetic elements in the figure below, how many different mRNAs and…

A: Ribosomes have the ability to convert every mRNA molecule into polypeptides. Beginning with the…

Q: Define (whether post-transcriptional, post-translational, transcription) and describe the regulation…

A: Ferritin is a key player in controlling Fe levels in the body. It regulates the amount of Fe it…

Q: How can one primary transcript result in several polypeptides with different amino acid sequences.…

A: Primary transcript is called as Heterogeneous nuclear RNA or hnRNA. It has Introns and Exons. Exons…

Q: During RNA splicing

A: Answer: TRANSCRIPTION : It is the process of central dogma where DNA is transcribed in to RNA using…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.