Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences)
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Below is an mRNA molecule in its wild type form.
5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’
An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is:
5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’
- What type of mutation has occurred? (max 1 sentence)
- Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence)
- Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences)
Responding in point form is allowed!

Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 3 images









