MRNA 1 20 ORI 40 60 TТCGAGCTCTCGТССТCGAGATACGCGATGATATTACTGGTAАТАТСGGGAТССАСТАТС AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇCCCTACGTGATAG 3' 5' promoter RNA polymerase Practice Question 4 A) Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you know? ribosome ||
Genetic Recombination
Recombination is crucial to this process because it allows genes to be reassorted into diverse combinations. Genetic recombination is the process of combining genetic components from two different origins into a single unit. In prokaryotes, genetic recombination takes place by the unilateral transfer of deoxyribonucleic acid. It includes transduction, transformation, and conjugation. The genetic exchange occurring between homologous deoxyribonucleic acid sequences (DNA) from two different sources is termed general recombination. For this to happen, an identical sequence of the two recombining molecules is required. The process of genetic exchange which occurs in eukaryotes during sexual reproduction such as meiosis is an example of this type of genetic recombination.
Microbial Genetics
Genes are the functional units of heredity. They transfer characteristic information from parents to the offspring.
Step by step
Solved in 2 steps
