NOTE THIS: DECODE IT PLEASEJUST PROVIDE A BRIEF ANSWER.PLEASE HELP ME OUT, I'M BEGGING YOU PLEASE.THANK YOU SO MUCH IN ADVANCE DNA RepilicaTCC COG GTAGAC ATT TTA TTG CCAGTC AAT AAC GCCTTT TTC CACAGA TATACATGTMRNA StrandtRNA StrandAA SequencePhenotype ASSESSMENT SHEETSUNIT 1. HEREDITY: INHERITANCE AND VARIATIONACTIVITY 1. DECODING GENESDirections: Transcribe the DNA template into its complementary MRNA. Then, pair the codons tocorresponding tRNA. Using the amino acid chart on page 3, translate the genes in the TRNA intoproteins. After you have finished translating your tRNA strand into proteins, determine theorganism's phenotype and sketch it at the back of this page. The first set is given with correctanswers for your guide.Protein (AASequence)Protein (AASequence)PhenotypePhenotypeGenesGenesval-ser-leufurhis-ilecurly hairВоdyCovering val-ser-lysHairfish scaleshis-hisstraight hairtyr-pro-gln-gin-lysmuscularser-pro-valblue pigmentBody StylePigmentval-pro-thr-pro-lysval-phe-tyrred pigmentslimround eyesasp-ile-leu-leu-pro-thrleu-leu-leu-profish-tailedLegsEyesleu-leu-ser-ala2 leggedasp-iso-pro-pro small eyes-pro-thrala-val-valround headval-asn-asn-ala wide mouthHeadMouthval-ala-alapointed chinsmall mouthasn-asn-asn-FOR PRIVATE USE ONLYPage 6 of9Leaming Packet ASNo part of the leaming sadket ahallbe praduced capied aracerced withaun the permiaien af the auther and the schoalScence 10 (Weekalaroundfloppybulging biceps;8 fingersphe-ser-glyarg-tyr-cysEarsearsArms andphe-phe-hispointed standingHandsarg-arg-asnslim arms; 10earsfingers

DNA is converted into mRNA by transcription. mRNA has the codons, complementary sequence of the DNA…

Answered: DNA Repiica TCC cca GTA GAC ATT TTA TTG…

DNA Repiica TCC cca GTA GAC ATT TTA TTG CCA GTC AAT AAC GcC TTT TTC CAC AGA TAT ACA тот MRNA Strand tRNA Strand AA Sequence Phenotype

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 15SQ: Match the terms with the best description. ______ genetic message a. protein-coding segment ______...

See similar textbooks

Similar questions

Choose the correct option for following three mcqs 10.Which of the following statements regarding solenocysteine is TRUE: It is represented by one of the cysteine codons It is called the 22nd amino acid A tRNA synthetase directly couples solenocysteine to a tRNA It is represented by the start codon AUG All of the above statements are false. 11.The process through which one gene can produce multiple types of proteins is called: RNA splicing Alternative splicing Translation Alternative translation None of the above 12.One feature which is shared by self splicing Group-I and Group-II introns is: Both contain an adenine at their branch point Both contain a guanine at their branch point Neither requires energy for intron removal Both depend on other RNAs for intron removal Neither intron assumes any secondary structure
Third letter UCAG UCAGH CAC First letter Part 5: Coding Practice 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? C. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! bac ocent Seond letter UUU Phe UAU Tyr UGU UGC Cys UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp G C. UUA UCA UUG Le UCG [ CAU ] CAC CUU CGU His CUC C CGC ne. CCA Arg Pro CUA CAA CGA CCG CAG Gin CGG CUG AAU 1 AAC Asn ACU AGU [ [ AUU AUC Ile AGC Ser Thr A AUA AGA AGG ACA AAA Arg AUG Met ACG AAG GUU GCU GAU GGU Asp GAC GCC GGC GUC Val G GUA GCA Ala GAA GGA Gly GAG Glu GGG GUG GCG
A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%
General Instruction: Answer the following questions completely. 1. Construct a Venn Diagram to compare and contrast the structure and function of DNA and RNA. DNA RNA 2. The Continuity of life is based on heritable information in the form of DNA, and structure and function are correlated at all levels of biological organization. Describe how the structure of DNA is correlated with its role as the molecular basis of inheritance. (Answer must be in 3- 5 sentences only).
Q3. Using the mutated DNA parental template sequence, follow it through to the resulting polypeptide sequence. Show where the mutation occurred, what type of mutation it likely was and what the resulting effect would be. Did this change in the DNA sequence cause any significant change to the protein produced? Explain. Mutation 3'-TAC TTTG CAATCGTCA ATAGCCATT
Bio1B 3/23 DNA/Protein Syntl X S le festin song analysis | Schoo X G what compounds are re /common-assessment-delivery/start/4797160920?action%3Donresume&submissionld%3D468979669 Ai. English 9 Student D. S ddddddddddddddd... Type of Genetics Cr. S TEWWG Chap DNA Protein Synthesis Test DNA REPLICATION 1. The enzyme is responsible for unzipping the helix to start the process of replication. 2. is responsible for adding new nucleotides to the template strand during replication. 6 7 8 9 10 11 ment-delivery/start/47971609207action-onresume&submissionid-468979669# Support | Schoology Blog | PRIVACY PO
Final Assessment for Exploring M X forms/d/e/1FAIpQLSe8RrfvHEr59pISGjbEneL041GxKTvyw9-Xc_EA7Um_8xqReA/viewform?hr_submission-Chg1990yzQ8SEAjwvY285... First mRNA base (5) end of codon) A Sequence C Sequence D 5. A DNA sequence of "ACG" will code for the amino acid UUG CUC CUA CUG wh GUC GJA GUG Cys 100 AUU AUC lle ACC AUA ACA AUG MACG] Val M Second mRNA base UCA UCG The GCU GCC.. GCA GIGA CAA CAG Tyr UAC UGC UAA Stop UGA Stop A UAG Stop UGG Tro AAU AAC MT AAC GAC GAG 2 Lys Asp CGA CGG AGU AGC AGA AGG Lys GGU GGC GGA GGG Arg DUAU Gly C Third mRNA base (3' end of codon) Lys (K) DELL C GU A C DEOTOCCAGUCAGUCAGUCHOSOTOS M G (F) A (LS1-1) * GU A C CUGA OPCUGACU GACUSACCO AD A G OCO Trp (W) \u« 9799%3Fo 33 4
Answer the ff. DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' A. is the 3rd amino acid in the peptide produced from the N-terminal B. is the 2nd amino acid in the peptide produced from the C-terminal C. is the anticodon present in the tRNA that carried the 5th amino acid from the N-terminal D. is the anticodon present in the tRNA that carried the 3rd amino acid from the C-terminal E. is the % of adenine in the DNA complement of DNA fragment A
HO a. b. d. 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What protein sequence would result from this strand of MRNA End End a. DNA MRNA 5' AUG – CCG - UAG - UGC - CGA – UAG b. Protein 9. In the DNA double helix, why are purine bases on one DNA strand never paired with purine bases on the opposite strand? There is more than one reason. 31 C.
Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:
Tn Midterm test Fall 2020 (page 2 of x A elearn.squ.edu.om/mod/quiz/attempt.php?attempt3D1335328&cmid%3D6971498page=1 SQU E-leaning System (Academic) Question 21 The direction of mRNA molecule synthesis is .: Not yet answered Select one: Marked out of O a. From DNA strand that starts with 5' 1.00 O b. In the direction of 3' to 5 P Flag question O c. From DNA strand that starts with 3' O d. From RNA strand that starts with 3' O e. From RNA strand that starts with 5' Question 22 Which of the following organelles do plants and animals have in common? Not yet answered Select one: Marked out of O a. mitochondria, ribosome, nucleus, cell membrane, cytoplasm 1.00 O b. mitochondria, vacuole, nucleus, cell membrane, cell wall F Flag question O c. mitochondria, vacuole, nucleus, cell membrane, centrioles O d. mitochondria, vacuole, nucleus, cell membrane, cell wall, chloroplasts O e. mitochondria, vacuole, nucleus, cytoplasm, cell wall, lysosome
Learning Task 2: Make a model of a DNA template to determine the sequence of bases in th new DNA strands. Then, answer the guide questions that follow. Materials: crayons. Scissors, paste/tape, used folder or illustration board Procedure: Use the pattern of the DNA template: (attached to this LP). Color code, phosphate - blue, deoxyribose sugar = green, nitrogenous base as follows: adenine= yellow, thymine pink, guanine = violet, cytosine = red. And cut the shapes of each nucleotides. Build a model of a strand of a DNA molecule. The strand should contain 6 base" rungs" following the given order of the nucleotides: Guanine, Adenine, Cytosine, Thymine, Cytosine, Guanine. %3D %3D Tape the cutout pattern to form the nucieotides. This will represent the left half of DNA. Make a complementary strand that you made in step 3. Tape the cut -out pattern again forming the nucieotides for the second strand of the DNA molecules. Match the bases of the first strand and the second strand. Do not tape…