6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA- CCCATAATTCTGATTGTATAATGAGTCATTGAATAGTAACAT DNA- GGGTATTAAGACTAACATATTACTCAGTAACTTATCATTGTA MRNA-5'-GAUUGUAUAAUGAGUCAUUGAAUAGUAACAU-3' a) Translate this mRNA, the start codon is underlined. b) Which strand of DNA is the non-coding strand? c) Label all ends of the DNA with a 5' or a 3'

6. The normal sequence a DNA and the MRNA transcribed from it are shown below. DNA- CCCATAATTCTGATTGTATAATGAGTCATTGAATAGTAACAT DNA- GGGTATTAAGACTAACATATTACTCAGTAACTTATCATTGTA MRNA-5'-GAUUGUAUAAUGAGUCAUUGAAUAGUAACAU-3' a) Translate this mRNA, the start codon is underlined. b) Which strand of DNA is the non-coding strand? c) Label all ends of the DNA with a 5' or a 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
ii
5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence.
30)
Using the genetic code below, decipher the following mRNA sequence. 5'CCCGGGAUGCGGUGUUGGUUUUAACCCGGG3' (show all work)
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.