You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TCGAG ATACGCGATGATATTACTGGIAATATGGGGATGCACTATC 3' ТTCGAGCTCТСGTCGTCO 5' AAGCTCGAGAGCAGCAGCTCTАTGCGCTАСТАТААTGACCAТТАТАCЕССТАСGTGATAG RNA promoter polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TCGAG ATACGCGATGATATTACTGGIAATATGGGGATGCACTATC 3' ТTCGAGCTCТСGTCGTCO 5' AAGCTCGAGAGCAGCAGCTCTАTGCGCTАСТАТААTGACCAТТАТАCЕССТАСGTGATAG RNA promoter polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

Name: You study the expression of the hexose kinase gene and capture the fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You study the expression of the hexose kinase gene and capture the following electron micrograph ofthe gene being expressed.mRNA20ORI40603'GATATTACTGGIАAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAGTTCGAGCTCTCGTCGTCGAGATACGCGATGATGGTAAT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Related questions

Q: DNAT A C C A C C C C C G T A T G G C T G G G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: PYK gene codes for the expression of pyruvate kinase, which is one of the enzymes targeted for…

A: Pyruvate kinase is the final enzyme in the glycolytic pathway which ultimately forms pyruvate from…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: 1. You are stuaying regulation of peri gene expi amounts of Per1 mRNA and protein in normal cells…

A: PER1 transcription is regulated by protein interactions with its five E-box and one D-box elements…

Q: In unit 1 we learned about the CFTR gene that codes for a chloride channel that does not function…

A: Cystic Fibrosis (CF) is a genetic disorder that is caused by mutations in the CFTR gene. This gene…

Q: Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins, they…

A: Proteins called transcription factors bind to adjacent DNA to control the transcription of genes.…

Q: The following images represent confocal images of cells with full-length Mira protein (Mira 1-830),…

A: Confocal microscopy creates an image of a specimen by filtering out the out-of-focus light coming…

Q: MRNA transcripts can be collected from cells, made to glow with a fluorescent dye, and added to a…

A: m RNA separated from hepatocytes will bind to those genes present on the microarrays which has its…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: 11. You isolated a gene expressed in differentiated hepatocytes in mice. You then fused various…

A: A gene consists of promoter, enhancer, silencer, functional gene, introns ,termination sequences…

Q: What region would provide cell type-specific expression of genes? region What site would…

A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: At which of the following level(s) can gene expression be regulated in eukaryotes?

A: Introduction Gene expression is the process through which information from a gene is used to create…

Q: As shown in Figure 13-22, how many different transcription factors govern where the Distal-less…

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: summarize these results using concise language in a neat table; Control : 5’…

A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…

Q: You use a Northern Blot to probe a sample of muscle tissue for a particular MRNA transcript. You…

A: Northern blotting is used to detect and identify the presence of specific molecules of mRNA. In this…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to determine the length of the Sh protein in amino acids (AA's)…

Q: Quick activity Use the genetic code to translate the following 30 nt mRNA sequence:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

You study the expression of the hexose kinase gene and capture the following electron micrograph of
the gene being expressed.
mRNA
20
ORI
40
60
3'
GATATTACTGGI
АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG
TTCGAGCTCTCGTCGTCGAGATACGCGATGAT
GGTAATATGGGATGCACTATC
5'
promoter
RNA
polymerase
Practice Question 4
E)
You also study the expression of different mutants for this gene.
Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position
30 (position denoted by the * in the sequence above).
For mutant A answer the following:
Does this mutation change the sequence of the protein produced? Why or why not?
If it does change the sequence of protein be sure to write out the new sequence.
If it does not change the protein sequence, what effect (if any) would you expect it
to have on expression of the gene?
1
20
ORI
40
60
3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'
5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3'
promoter
ribosome

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following schematic for a gene and its associated regulatory regions, answer the following questions by placing the correct letter in the provided blanks i need help find a letter for all the blanks
The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!
Searching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…
Direct mutagenesis of Ca2+ ATPase gene resulted in the replacement of two amino acid residues - Asn111 and Asn114 to Ala. These substitutions led to the reduction in Ca2+ transport activity by 10% and 50%, respectively. On the other hand, directed mutagenesis that resulted in the alteration of four Glu residues in the lumenal loop of this transport protein to Ala, did not affect the Ca2+ transport. Provide the possible explanation for the observed differences in the Ca2+ transport activity between the protein with Asn->Ala substitution and the protein with Glu->Ala substitution.
Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a transcription factor. You have identified a novel variant in WT1: Arg422Pro. You have control cells and cells that have been engineered to carry the homozygous WT1 p.Arg422Pro mutation. You want to assess effects of this mutation on a variety of endpoints. For each endpoint listed below, choose the one technique is best suited to answer the question. Choose from: array CGH, qRT-PCR, qPCR, RNA-seq, FISH, in situ hybridization, western blot, immunostaining, WT1 ChIP-seq, WT1 ChIP-PCR, ATAC-seq, 3C Endpoint Technique? WT1 protein amount (quantitative) Western blot WT1 protein binding to all enhancers, genome-wide Chip-seq WT1 mRNA amount (quantitative) WT1 protein subcellular localization Quantitative assessment of all mRNAs in these cells (genome-wide) RNAseq Chromatin interactions between a specific WT1 chromatin binding site (identified above)…
The following question refers to the transcriptional control of the Gal7locus in Saccramyces cerevisiae. What is the predicted Gal7 expression phenotype (inducible,uninducible, constitutive) of the following mutant strains?
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Give typing answer with explanation and conclusion
O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
e B 1_30*_SP23 - General Biology I (for majors)/11364 of € 2 A us page X F1 What conditions would we find on the gene of a prokaryote if there is low amounts of tryptophan within the cytoplasm? Select one: a. lactose would attach to the repressor removing it from the promoter promoting the transcription of lactase b. no repressor is on the promoter creating constant transcription of lactase c. tryptophan would attach to the repressor removing it from the promoter promoting the transcription of lactase O d. repressors would bind to the promoter stopping the transcription of lactase e. lactose would attach to the repressor removing it from the promoter promoting the transcription of tryptophan producing enzymes no repressor is on the promoter creating constant transcription of tryptophan producing enzymes tryptophan would attach to the repressor binding it to the promoter and stopping the transcription of tryptophan producing enzymes O f. O g. 2 Oh. tryptophan would attach to the…
The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three structural genes, lacZ, lacY and lacA. Which structural genes are involved in lactose metabolism? Explain. (ii) Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote. (iii) What is the function of the promoter in the bacterial operon?
The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?