You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TCGAG ATACGCGATGATATTACTGGIAATATGGGGATGCACTATC 3' ТTCGAGCTCТСGTCGTCO 5' AAGCTCGAGAGCAGCAGCTCTАTGCGCTАСТАТААTGACCAТТАТАCЕССТАСGTGATAG RNA promoter polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TCGAG ATACGCGATGATATTACTGGIAATATGGGGATGCACTATC 3' ТTCGAGCTCТСGTCGTCO 5' AAGCTCGAGAGCAGCAGCTCTАTGCGCTАСТАТААTGACCAТТАТАCЕССТАСGTGATAG RNA promoter polymerase Practice Question 4 E) You also study the expression of different mutants for this gene. Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position 30 (position denoted by the * in the sequence above). For mutant A answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'..TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter ribosome

Name: You study the expression of the hexose kinase gene and capture the fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You study the expression of the hexose kinase gene and capture the following electron micrograph ofthe gene being expressed.mRNA20ORI40603'GATATTACTGGIАAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAGTTCGAGCTCTCGTCGTCGAGATACGCGATGATGGTAAT

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Related questions

Q: DNAT A C C A C C C C C G T A T G G C T G G G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: CGA CUA CCA UCA ACA GUA GGA GGC CCGC AUA CUC CCC UCC ACC GUC 3 CGG GAC AAC UGC GAA CAA GGG CAC AUC…

A: The process of synthesis of proteins with the help of messenger RNA is called translation. Proteins…

Q: Transcription factors function in the nucleus. However, like (almost) all eukaryotic proteins, they…

A: Proteins called transcription factors bind to adjacent DNA to control the transcription of genes.…

Q: The following images represent confocal images of cells with full-length Mira protein (Mira 1-830),…

A: Confocal microscopy creates an image of a specimen by filtering out the out-of-focus light coming…

Q: MRNA transcripts can be collected from cells, made to glow with a fluorescent dye, and added to a…

A: m RNA separated from hepatocytes will bind to those genes present on the microarrays which has its…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: 11. You isolated a gene expressed in differentiated hepatocytes in mice. You then fused various…

A: A gene consists of promoter, enhancer, silencer, functional gene, introns ,termination sequences…

Q: What region would provide cell type-specific expression of genes? region What site would…

A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.

Q: At which of the following level(s) can gene expression be regulated in eukaryotes?

A: Introduction Gene expression is the process through which information from a gene is used to create…

Q: S-Cdk is likely to be a [Select] The inhibitor of Ras is likely to be a [ Select] < The MAP kinase…

A: Cell signaling is the process by which cells communicate with each other and respond to signals from…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: summarize these results using concise language in a neat table; Control : 5’…

A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…

Q: You use a Northern Blot to probe a sample of muscle tissue for a particular MRNA transcript. You…

A: Northern blotting is used to detect and identify the presence of specific molecules of mRNA. In this…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to determine the length of the Sh protein in amino acids (AA's)…

Q: Quick activity Use the genetic code to translate the following 30 nt mRNA sequence:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

You study the expression of the hexose kinase gene and capture the following electron micrograph of
the gene being expressed.
mRNA
20
ORI
40
60
3'
GATATTACTGGI
АAGCTCGAGAGCAGCAGCTCТАTGCGCTACТАТААТGACCАТТАТАСЕССТАCGTGATAG
TTCGAGCTCTCGTCGTCGAGATACGCGATGAT
GGTAATATGGGATGCACTATC
5'
promoter
RNA
polymerase
Practice Question 4
E)
You also study the expression of different mutants for this gene.
Mutant A has a single base pair substitution with the C/G being replaced with G/C base pair at position
30 (position denoted by the * in the sequence above).
For mutant A answer the following:
Does this mutation change the sequence of the protein produced? Why or why not?
If it does change the sequence of protein be sure to write out the new sequence.
If it does not change the protein sequence, what effect (if any) would you expect it
to have on expression of the gene?
1
20
ORI
40
60
3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5'
5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3'
promoter
ribosome

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

INTERPRET DATA Develop a simple hypothesis that would explain the behavior of each of the following types of mutants in E. coli. Mutant a: The map position of this mutation is in the trp operon. The mutant cells are constitutive; that is, they produce all the enzymes coded for by the trp operon, even if large amounts of tryptophan are present in the growth medium. Mutant b: The map position of this mutation is in the trp operon. The mutant cells do not produce any enzymes coded for by the trp operon under any conditions. Mutant c: The map position of this mutation is some distance from the trp operon. The mutant cells are constitutive; that is, they produce all the enzymes coded for by the trp operon, even if the growth medium contains large amounts of tryptophan.
Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to regulate their transcription. Assume that a particular transcription regulator normally promotes transcription of gene X, a transport protein. If a mutation makes this regulator gene nonfunctional, would the resulting phenotype be similar to a mutation in gene X itself? Why or why not?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle troponin T gene (Figure 29.46). How many different mRNAs could now be generated by alternative splicing? Suppose that exon 7 in a wild-type troponin T gene were duplicated. How many different mRNAs might be generated from a transcript of this new gene by alternative splicing?
Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant sickle cell anemia allele of beta globin. This mutation destroys an MstII restriction site normally present in the beta globin gene. This difference between the normal allele and the mutant allele can be detected with Southern blotting. Using a labeled beta globin gene as a probe, what differences would you expect to see for a Southern blot of the normal beta globin gene and the mutant sickle cell gene?
Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside triphosphates: the initiation site and the elongation site. The initiation site has a greater Km for NTPs than the elongation site. Suggest what possible significance this fact might have for the control of transcription in cells.
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Through alternative splicing, eukaryotes (a) reinforce gene inactivation (b) prevent transcription of heterochromatin (c) produce related but different proteins in different tissues (d) amplify genes to meet the requirement of high levels of a gene product (e) bind transcription factors to enhancers to activate transcription
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups from histone proteins. Explain how these drugs could affect gene expression to help kill tumor cells.
Post-transcriptional Modification of Eukaryotic mRNAs What might be the advantages of capping, methylation, and polyadenylylation of eukaryotic mRNAs?
The Lariat Intermediate in RNA Splicing Draw the structures that comprise the lariat branch point formed during mRNA splicing: the invariant A. its 5â€™-R neighbor, its 3â€™-Y neighbor, and its 2â€™-G neighbor.