-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)

Q: Gene A Gene B Gene C Low levels of gene A transcription generates some transcripts of the gene. No…

A: A gene is a fundamental unit of heredity and a sequence of nucleotides in DNA or RNA that encodes…

Q: 5' CAP-Exon1-Exon3-Exon4-AA..AAAA 5' CAP-Exon1-Exon2-Exon3-Exon4-AA..AAAA O 5'…

A: Mature mRNA are those mRNAs that has been spliced and processed and is ready for translation in the…

Q: Label the diagram to explain how the ncRNA HOTAIR plays a role in gene expression. Nearby histones…

A: A long non-coding RNA (nc RNA) molecule is HOTAIR (HOX Transcript Antisense Intergenic RNA). A type…

Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…

A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…

Q: In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group?…

A: Introns are the inert elements in the DNA. They are otherwise said to be non coding regions of DNA…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The process of transcription starts at the +1 site, which is determined by the promoter. In…

A: All description given in this question though in brief transcription is a process where RNA produce…

Q: Which of the following eukaryotic MRNA transcripts would NOT be able to be translated? Select ALL…

A: Translation  It is defined as the process of formation of proteins by the ribosomes present in the…

Q: How does the fact that mRNA is quickly degraded help a cell control gene expression?

A: A gene is an essential unit of heredity and an arrangement of nucleotides in DNA or RNA that encodes…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP…

A: Transcription is the process of formation of mRNA from DNA template strands by an enzyme called RNA…

Q: 1 5'- TATATACTGT ATGGTGGGTT GATCTATGTA TCAACAGTAC GGCTCGCAGG TACCCGATGA GATGGGAAGG TGGGTTGACA…

A: Introduction :  The genetic code is a system of rules that living cells use to interpret the…

Q: You are working on a protein for a research project. The protein does not express well in…

A: Yeast is a eukaryotic organism that possesses a network of internal membranes to sort proteins to a…

Q: . In bacterial genes, as soon as any partial mRNA transcriptis produced by the RNA polymerase…

A: Messenger RNA (mRNA) molecules carry the coding sequences for macromolecule synthesis.

Q: The following are examples of how eukaryotic cells may control gene expression small RNA molecules O…

A: The eukaryotic genome is huge and consists of millions of base pairs. It is highly packed in…

Q: The following are examples of how eukaryotic cells may control gene expression O small RNA molecules…

A: The process by which the information stored in a gene is used to control the assembly of a protein…

Q: A gene is about to be transcribed. Draw a cartoon/ diagram of double stranded DNA that contains this…

A: A gene is the segment of DNA( Deoxyribonucleic acid) , When a gene is transcribed it means the…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: Which term describes each of these steps or substeps in the translation process? The ribosome shifts…

A:

Q: . (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3     AAU…

A: Ans - a.)  AUG is the start codon in the mRNA 5 - AAUAUGCGGAUGCCCGAA -3. # AUG acts as initiator…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Eucaryotic

A: Introduction:-  Heterogeneous nuclear RNA or hn RNA is a term that encompasses various types and…

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…

Q: Upon going through the complete process of gene expression, which amino acid would be most likely to…

A:

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: Last word is anterior

A: One could make transgenic flies that contain a series of deletions spanning ALL SEGMENTS of the…

Q: Which of the following is NOT a true statement about the 5' cap? O A. The Cap Binding Complex (CBC)…

A: The five-prime cap (5′ cap) is a specially altered nucleotide on the 5' end of some primary…

Q: Please study the diagram above on eukaryotic gene expression. In order to provide instructions for…

A: EXPLANATION : Noncoding DNA is also found within most of the eukaryotic genes. Such genes have a…

Q: From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to…

A: Regulatory proteins are any protein that affects the sections of a DNA molecule that RNA polymerase…

Q: Label if each of the fonowing Sequences are present in DNA, pre-RNA andlor MRNA Of eukanyotes :…

A: All the information is present in the DNA that will be required for the synthesis of proteins. In…

Q: Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a…

A: The mutation is simple known to state towards the   a term that  used to describe a change in the…

Q: From the list given - choose all the regulatory sequences that you think would control the…

A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…

Q: Genetic expression involves transcription and translation. Match the structure or molecule to the…

A: We all know that central dogma is a very basic and important procedure in every cell.There are…

Q: Select all that is true about transcription in eukaryotes. 1.Introns get spliced out of pre-mRNA…

A: Ans- All are true, except Transcription occurs simultaneously and in the same place as translation.

Q: What is NOT true about the function of RNA polymerase? O its rate of activity is similar for all the…

A: Promoter sites are short DNA sequences found in the promoter region of a gene. They act as binding…

Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’   An…

A:

Q: Choose all that apply regarding gene transcription in eukaryotes: Multiple transcription factors are…

A: Transcription in eukaryotes.

Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…

A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…

Q: Match the term to its best definition. molecule with high-energy bond that carries amino acid to…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis…

Q: What are the amino acids encoded by gene Z?

A: Given information The promoter is from the 20-55th position in the sequence. The ribosome binding…

Q: help

A: The mutations causing most likely (1) to least likely (4) a loss of the function of the encoded…

Q: 1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 -…

A: The protein is synthesized by the translation process. It takes place in the cytoplasm.

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…

Q: Shown below are different regions of an eukaryotic gene. Which of the above regions of a gene will…

A: Transcription is the process by which the information in a strand of DNA is copied into a new…

Q: Let's say there is an eukaryotic gene that has five exons and 4 introns. If the GU sequence at the…

A: The process by which entrance are removed from heterogeneous nuclear RNA to form mRNA is called…

Q: help

A: The copying of the template DNA on the mRNA is called transcription. The formation of mRNA is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.