The process of transcription starts at the +1 site, which is determined by the promoter. In prokaryotes, the +1 site is 10 nucleotides downstream of the promoter, and in eukaryotes, the +1 site is 25 nucleotides downstream of the promoter. Bacterial Genes start transcription by recognition of the promoter sequence (TATAAT) with the second T located at the -10 position, with the promoter on the nontemplate strand. 2. Using the double stranded bacterial sequence provided below: - Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT) strand and the template strand (T) - Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence between -1 and +1. - Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific nucleotides that will be transcribed. - Transcribe the appropriate part of the DNA into mRNA. Indicate the 5' and 3' ends of the new MRNA. 5' GGCATGTАТААTGGCACCGTAGTCATGCCсGACGCATTTA 3' 3' CCGTACATATTACCGTGGCATCAGTACGGGCTGCGTAAAT 5'

Q: Puberty in boys- What principal signs of puberty and hormonal control do they have. at what age do…

A: Hormones are the chemical which help control and regulate basic functions of the body including:…

Q: Hormone Which part Target Organ(s) Function of the pituitary releases it? Охytocin Antidiuretic…

A: All organisms have the ability to coordinate their activities with constant changes in the…

Q: Assessing effectiveness of adrenergic blocking agents for BPH

A: BPH(Benign Prostatic Hyperplasia) is medical condition caused due to enlargement of prostate gland,…

Q: The adrenal medulla consists of modified postganglionic neurons of the _____ nervous system.

A: Answer is Autonomic Nervous System .

Q: Endocrine glands and the hormones they release

A: The endocrine system is the chemical signaling system that uses blood vessels as information…

Q: When FSH levels increase in a female (select ALL appropriate),

A: Follicle-stimulating hormone (FSH) is a glycoprotein polypeptide hormone and plays an important part…

Q: Interior pituitary hormones undersecreation and oversecreation.

A: Major Anterior Pituitary Hormones FSH Luteinizing Hormone (LH) Prolactin Adrenocorticotropic hormone…

Q: How calcium is regulated in the body by calcitonin and parathyroid hormone (PTH).

A: Calcium homeostasis deals with maintaining calcium levels in the body. Calcitonin and parathyroid…

Q: How the insulin help to control the glucose level

A: Introduction: Insulin is a hormone that is important in regulating blood glucose levels. A shortage…

Q: Adrenal cortex. Which is correct regarding the "salt" zone? O islets / insulin O interstitial cells…

A: The glands which are shaped like a triangle and which are located at the top of each kidney are…

Q: Which of the following is NOT a steroid molecule? O estrogen insulin cholesterol testosterone

A: Estrogen is a female sex steroid hormone whereas testosterone is a male sex steroid hormone.…

Q: Neurophasial hormones function and over and undersecreation

A: Neuro hypophyseal hormones are produced by hypothalamus. These hormones are secreted by the para-…

Q: Negative and positive feedback in regulating hormones

A: Introduction:- The ability or capacity of the organism or a cell to seek and maintain a state of…

Q: H DE Thyroid: J K т L B C D E G F

A: Glands secrete chemical substances. They secrete either directly or via duct. Exocrine glands…

Q: True or false. After dopamine is repressed into the synaptic cleft it can be broken down by two…

A: The nerve impulse propagation from one neuron to the next neuron occurs either by chemical synapse…

Q: QUESTION 19 The hypothalamus communicates with the anterior pituitary through a neural network. O…

A: The objective of the question is to determine whether the hypothalamus communicates with the…

Q: Which two hormones are reduced by ACEi or ARB

A: Answer well explained above

Q: Hormone Producing Structures, their Hormones & Hormone Functions

A: Endocrine glands secrete hormones. These are also called ductless glands because they do not have…

Q: What drug(s) does Suzanne seem to be most addicted to?

A: A chronic, recurring illness called addiction is characterised by obsessive drug seeking and usage,…

Q: The role of hormones in the regulation of mental, physical development, linear growth of the body.

A: Hormones are the chemical messengers which are released by specialized glands. These glands are…

Q: T-type calcium channels inactive rapidly.  True  False

A: T-type calcium channels are predominantly found in neurons but have been found in other cells…

Spheres of physical activity

The spheres of physical activity experience include aspects of everyday life where physical activity is important. In general, the spheres recognize various purposes of physical activity in different contexts. The spheres of physical activity provide a broad basis for assessing the significance and prevalence of physical activity. There are seven spheres of physical activity experience.