Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 8P
Wild
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin:
Normal GGG CTT CTT TTT
Sickle GGG CAT CTT TTT
A)Transcribe and translate the normal and sickle cell DNA.
B)Identify this as a point or frameshift mutation. Explain.
When human hemoglobin undergoes a mutation, the
mutant protein usually does not replace all of the normal HbA in
the red blood cells or erythrocytes of the individual. The erythro-
cytes contain mixtures of varying amounts of both HbA and the
mutant protein depending on the mutation and the individual. Hb
Yakima is a mutant human Hb with an Asp-(B99)His mutation.
The diagram on the right shows that Hb Yakima was separated
by DEAE-cellulose chromatography from HbA with a 0 – 0.1 M
linear gradient of NaCl buffered to pH 8.3. Why is chromatog-
raphy carried out at pH 8.3? If the isoelectric point of HbA is 6.85,
what is the change in total charge caused by the mutation?How
does the change in charge explain the chromatography elution
profile of the Hb Yakima/HbA mixture?
1,5
-Hb-A
Hb -Yakima
1.0
0.5-
20
40
60
80
00
Fraction number
O.D578 nm
Chapter 10 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 10 - Define the following terms as described in this...Ch. 10 - 2. Using sickle cell disease as an example,...Ch. 10 -
3. Compare and contrast the contributions of...Ch. 10 - Why do differences in protein electrophoretic...Ch. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - 8. Wildtype βglobin protein is composed of amino...Ch. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - 11. How is an autoradiograph produced from a...Ch. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - The family represented in the pedigree and...Ch. 10 - Suppose the mating couple (I-1 and I-2) shown in...Ch. 10 - What are restriction endonucleases, and why are...Ch. 10 - 18. Following restriction digestion, DNA fragments...Ch. 10 - 19. The doublestranded DNA sequence below is part...Ch. 10 - 20. Restriction enzymes recognize specific...Ch. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - 25. A second strain of dwarf plants has a...Ch. 10 - During gel electrophoresis of linear DNA...Ch. 10 - Prob. 27PCh. 10 - 28. In molecular biology, restriction...Ch. 10 - A complete plant gene containing four introns and...Ch. 10 - Prob. 30PCh. 10 - The map below illustrates three alleles in a...Ch. 10 - Prob. 32PCh. 10 - 33. Northern blot analysis is performed on mRNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown in the following table are several amino acid substitutionsin the a and b chains of human hemoglobin. determine how many of them can occur as a result of a single nucleotide change.arrow_forwardThe proximal histidine residues have been replaced by glycine residues by mutation of the cloned genes for both the α and β subunits of hemoglobin. With the tetrameric mutant hemoglobin (all subunits being mutant, α H F8 G, β H F8 G), it was found that the “proximal” coordination bonds to hemes in the mutant protein could be replaced by having the small molecule imidazole in the buffers. Oxygen binding curves for the tetrameric mutant hemoglobin were measured. A. The degree of cooperativity in oxygen binding for the mutant hemoglobin (with imidazole present) would be expected to 1) increase 2) decrease 3) not be affected) compared with the normal protein. B. Justify your answer to part A in terms of what you know about the structural basis of cooperativity in hemoglobin. C. How would the Hill coefficient for the mutant be expected to change compared with nH for normal hemoglobin, which is ~3?arrow_forwardHurler syndrome is due to a mutation in a gene that encodes aprotein called α-l-iduronidase. This protein functions withinlysosomes as an enzyme that breaks down mucopolysaccharides(a type of polysaccharide that has many acidic groups attached).When this enzyme is defective, excessive amounts of the mucopolysaccharides dermatan sulfate and heparin sulfate accumulatewithin the lysosomes, especially in liver cells and connectivetissue cells. This accumulation leads to symptoms such as anenlarged liver and spleen, bone abnormalities, corneal clouding,heart problems, and severe neurological problems. The pedigreebelow contains three members affected with Hurler syndrome,indicated with black symbols. Based on this pedigree, does thissyndrome appear to follow autosomal recessive, autosomaldominant, X-linked recessive, or X-linked dominant inheritance?Explain your reasoning.arrow_forward
- Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardA heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forward
- The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forwardIdentify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’arrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forward
- A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. What type(s) of mutation may have occurred in the GS1 gene in strain A?arrow_forwardA scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. The scientist determines the nucleotide sequence of the coding strand of the GS1 gene from strain A. It is identical to the GS1 sequence from the wild type gene except for a single change occurring approximately 1⁄3 of the way into the GS1 open reading frame. A small region of the GS1 sequence (including the site where the mutation occurs) from the wild type and mutant strains is shown below. Wild type TGTCCTCGGCCACAAGTTCTCTATC Strain A TGTCCTCGGCCACTAGTTCTCTATC How has this…arrow_forwardA scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. Sequencing of the GS1 gene from strain B shows that it is identical to the wild type gene except for a single alteration (the replacement of one nucleotide by another). How might this account for the features of the GS1 protein produced by strain B?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY