Genetic Analysis: An Integrated Approach (2nd Edition)
Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 10, Problem 19P

The double - stranded DNA sequence below is part of a restriction fragment you wish to detect by autoradiography.

5'-…ATTCATGACGGACTATTCGAGAGCTGATGCAT…-3' 3'-…TAAGTACTGCCTGATAAGATCTCGACTACGTA…-5'

Identify which of the following molecular probes is the best choice for achieving the desired hybridization reaction. Indicate where on the upper or lower strand the probe will hybridize.

3'-TGATATCGTACCGAA-5'

5'-TGCCTGATAAGATCT-3'

3'-ACAGCCTAGTAAGAT-5'

3'-ACTGCCTGATAAGCT-5'

Blurred answer
Students have asked these similar questions
A sample of DNA with the sequence 5'- CTC GAG CGA AGC TCA ACC-3' he was obtained as a dry solid. The sample was dissolved in 1000 µl of deionized water ane mixed well. Ten microliters of the dissolved sample was then transferred to a new sampie tube and mixed with 990 ul of water, The dilute sample had A260 = 0.156. What was the concentration of the original sample (the solid dissolved in 1000 ul of deionized water)
The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505
Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY