Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 20P
Restriction enzymes recognize specific double
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?
The partial sequence of one strand of a double-stranded DNA molecule is
5'-GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG
-3'
EcoRI is a restriction enzyme that cleaves after G in the sequence 5'-GAATTC-3'. PstI is a restriction enzyme that cleaves after
A in the sequence 5'-CTGCAG-3'.
Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The first
strand of your duplex DNA fragment should be derived from the given strand sequence.
5'-
-3'
3'-
-5'
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.
In the tables below G^AATTC means that the end after cutting with enzyme will be:
-----G 3'
-----CTTAA 5'
GTGCA^C means that the end will be:
-----GTGCA 3'
-----C 5'
Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?
AccI
GT^CGAC
BamHI
G^GATCC
ClaI
AT^CGAT
NsiI
ATGCA^T
PstI
CTGCA^G
BglII
A^GATCT
TaqI
T^CGA
Chapter 10 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 10 - Define the following terms as described in this...Ch. 10 - 2. Using sickle cell disease as an example,...Ch. 10 -
3. Compare and contrast the contributions of...Ch. 10 - Why do differences in protein electrophoretic...Ch. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - 8. Wildtype βglobin protein is composed of amino...Ch. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - 11. How is an autoradiograph produced from a...Ch. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - The family represented in the pedigree and...Ch. 10 - Suppose the mating couple (I-1 and I-2) shown in...Ch. 10 - What are restriction endonucleases, and why are...Ch. 10 - 18. Following restriction digestion, DNA fragments...Ch. 10 - 19. The doublestranded DNA sequence below is part...Ch. 10 - 20. Restriction enzymes recognize specific...Ch. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - 25. A second strain of dwarf plants has a...Ch. 10 - During gel electrophoresis of linear DNA...Ch. 10 - Prob. 27PCh. 10 - 28. In molecular biology, restriction...Ch. 10 - A complete plant gene containing four introns and...Ch. 10 - Prob. 30PCh. 10 - The map below illustrates three alleles in a...Ch. 10 - Prob. 32PCh. 10 - 33. Northern blot analysis is performed on mRNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?arrow_forwardThe sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs 5'- G I A A T T C - 3' 3' - C T T A A l G - 5'arrow_forwardA molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)arrow_forward
- Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
- In the formation of recombinant DNA, a restriction endonuclease cuts a bacterial plasmid to give sticky ends. The DNA segments that are to be added to the plasmid are cleaved with the same restriction endonuclease. What aresticky ends and why is it important that the target DNA and the plasmid it will be incorporated into have complementary sticky ends?arrow_forwardA circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to produce a 3000 bp and a 2000 bp bands when visualized on an agarose gel. When digested with one enzyme at a time, only one band is visible at 5000 bp. If the first site for enzyme A (A1) is present at the 100h base, the order in which the remaining sites (A2, B1 and B2) are present is - (A) 3100, 5100, 8100 115. (B) 8100, 3100, 5100 (C) 5100, 3100, 8100 (D) 8100, 5100,. 3100arrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forward
- A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HpaII (recognition sequence is CCGG)arrow_forwardIf the sequence of base pairs along a DNA molecule occurs strictly at random, what is the expected frequency of a specific restriction enzyme recognition sequence of length (a) four and (b) six base pairs?arrow_forwardA 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License