Suppose you want to determine whether a particulargene X is important for specification of the pharynx,but mutations in this same gene disrupt embryonicdevelopment well before pharyngeal structures appear.How could you use myo-2::GFP, the myo-2 promoter,the DNA sequence of gene X, and your knowledge ofRNA interference (RNAi) to generate worms that lackgene X expression in the pharynx but express gene Xin all other tissues in which it is expressed in wildtype C. elegans?

Q: Discuss the similarities and differences between the bithorax and Antennapedia complexes in…

A: The Hox genes were initially discovered in Drosophila and they exist in two separate gene clusters…

Q: Pax6 is a gene that is involved in mammalian eye development. Mutations in this gene result in a…

A: The comparison of the eyes of humans, mice, and flies supports this component of Darwin's…

Q: This image shows the alignment of the promoter from the same gene (gene H) across multiple mammalian…

A: Introduction  The central promoter region of genes in archaea and eukaryotes contain a DNA sequence…

Q: A Drosophila egg that is bed lbcd may develop normally, but the adult fruit fly will not be able to…

A: Bicoid genes The bicoid gene or the bcd genes in drosophila are important genes that control the…

Q: YODA, the protein involved in the very first division in the zygote of Arabidopsis and in…

A: The words "elongated" and "shortened" expression are used in the context of genetic interactions and…

Q: WRT is a gene in C. elegans worms which is normally expressed in a specific stage of development.…

A: WRT is a gene in C. elegans which is normally expressed at specific stage of development. a) Several…

Q: In flies, the gap gene kruppel is expressed in a broad band in the middle of the embryo with giant…

A: Segmentation in Drosophila is a result of hierarchical and location specific expression of genes.…

Q: a. Explain how you could use worms transformedwith myo-2::GFP to find mutations that disrupt…

A: The alteration of the DNA sequence of the genome in an organism is termed as mutation. It is the…

Q: Answer the following questions based on the information given below: Act>CD2>Gal4 is a…

A: Detailed explanation: Let's break down how to identify cells expressing gene X based on the…

Q: Mammals are anatomically and physiologically more complex than roundworms, yet both organisms have…

A: Pleiotropy is defined as the process where a single gene controls or influences the expression of…

Q: 12. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: describe the arrangment of Hox genes on each chromosome in mammals in relation to their expression…

A: Hox genes are group of related genes that determine the basic structure and the composition or…

Q: In unit 1 we learned about the CFTR gene that codes for a chloride channel that does not function…

A: Cystic Fibrosis (CF) is a genetic disorder that is caused by mutations in the CFTR gene. This gene…

Q: 6) The functioning of the "Ras/MAPK" signal transduction pathway is absolutely essential in order…

A: Targeted therapy is a type of cancer treatment that targets proteins that control how cancer cells…

Q: In Drosophila the genes twist, snail, rhomboid and sog are expressed at differing positions along…

A: The DV axis in Drosophila refers to the dorsal-ventral polarity that is established during embryonic…

Q: Sometimes, cDNAs turn out to be “chimeras”; that is, fusions of DNA copies of two different mRNAs…

A: c dna is complementary dna.

Q: Prolactin is a protein hormone that, among other things, enables mammals to produced milk. Prolactin…

A: Note- Sorry, Since you have posted a question with multiple subparts so we will be solving the first…

Q: Please search and list a number of promoter sequences in DNA vectors that are compatible with…

A: Promoter sequences are DNA sequences that define the start of RNA polymerase transcription of a…

Q: You are investigating the expression of the dKB gene in the eukaryotic species. dKB mRNA in lung…

A: How eukaryotes express their genes is influenced by a variety of variables, such as gene loss,…

Q: Researchers have identified a mutation in the LMNA gene, which encodes some of the pro- teins in the…

A: The intermediate filament proteins lamins A and C are encoded by the LMNA gene, which is found on…

Q: 11. You isolated a gene expressed in differentiated hepatocytes in mice. You then fused various…

A: A gene consists of promoter, enhancer, silencer, functional gene, introns ,termination sequences…

Q: stream of their coding sequence. The interaction of these enhancers with specific pression. Gene A…

A: Transcription elements Are defined as the type of proteins that have the ability to do modification…

Q: () What is the function of RISC in eukaryotic gene expression?

A: Gene expression is the process of producing a specific protein. The expression of gene takes place…

Q: Propose a model that outlines, step-by-step, events that could reasonably generate the expression of…

A: The "Eve stripe protein" refers to a specific protein called "Even-skipped" (Eve) that is involved…

Q: You have identified an enhancer that drives Pax6 expression in the developing lens and cornea of the…

A: To explain in more detail, we need to break down the process step by step and analyze the northern…

Q: A loss of function mutation in the gene for the yeast regulatory protein GAL4 causes yeast to grow…

A: Regulatory protein GAL4 GAL4 regulatory protein in a positive regulatory protein. When it binds with…

Q: The Wnt planar polarity signaling pathway nor-mally ensures that each wing cell in Drosophila has a…

A: Gene expression is the phenomenon in which the gene expresses itself in the form of functional…

Q: Match the following transcription factors whose expression during embryonic development leads to the…

A: A. Late expression in the limb bud gives rise to autopod- Homeobox a13( hoxa13) The autopod…

Q: From gene expression studies on development of the gut, you have decided to study a gene called…

A: Gene expression is the process where the information encoded in a gene is used to direct the…

Q: The transcription factor Pax6 is required continuallyduring the life of a mouse (or a human) for the…

A: Pax6 is a kind of transcription factor which is required for the development of retina in mouse and…

Q: In class, we discussed the regulation of expression of the Trp biosynthesis enzymes. These are the…

A: When RNA polymerase binds to a DNA molecule, transcription can begin. This binding takes place at…

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Are there homologues for the identified gene in other…

A: Hi! As you have posted multiple questions, I will be answering the first question for you. If you…

Q: Could somone explain exactly what this means below? NOT HW just trying to get a better understanding…

A: To produce mice that are deficient for RAC1 in macrophages, female C57BL/6 mice homozygously…

Q: Based on the photographs shown, in which segments is the Antp gene normally expressed?

A: Antp or Antennapedia is the Hox gene that was for the first time discovered in Drosophila. Hox gene…

Q: . An interesting mutation in lacI results in repressorswith 110-fold increased binding to both…

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: You perform a northern blot to determine whether CFTR (Cystic fibrosis transmembrane conductance…

A: Cystic fibrosis transmembrane conductance regulator gene is involved in mucus, sweat and digestive…

Q: Contrast the effects of mutations in genes encoding sporulation-specific sigma factors with…

A: Introduction Mutation in sigma factors:- Sigma factors are subunits of all bacterial RNA…

Q: Discuss the morphological differences between the parasegments and segments of Drosophila. Discuss…

A: The developmental genes play an important role in guiding the development to find out what kind of…

Q: Please describe the regulatory role of enhancers that binds to responsible regulators to activate…

A: Enhancer arrangements are administrative DNA successions that, when limited by explicit proteins…

Q: Proteins such as Dicer and RDE-R are involved in RNAi inactivation of target gene expression and are…

A: RNA is a molecule that plays a central role in the process of protein synthesis. RNA is made up of…

Q: Which specialized gene product is responsible for the fusion of mononucleated skin fibroblasts into…

A: Positive feedback in gene regulation is an interesting phenomena observed in many organisms in…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.