representation of DNA replication. Complete your representation for a single helical turn. 2.  prepare a representation of how mRNA is formed in the nucleus  3.  Complete to build a Polypeptide. Start from the DNA template you made , the mRNA transcript formed, and finally the processed or synthesize

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: IV. CENTRAL DOGMA OF MOLECULAR Suppose the following base sequence was found in a 30-base polymer:…

A: Central Dogma:  Central dogma is a process by which information from DNA is converted into…

Q: 3c. there are three enzymes that go by the name of DNA polymerase 1 2 and 3. please describe the…

A: DNA polymerase helps in the synthesis of new strand of DNA. DNA polymerase is present in both…

Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: ***10. Fill in the blanks to describe the similarities between transcription and DNA replication.…

A:

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…

A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…

Q: Below is a coding strand of DNA. Assume the transcription start site is outside of this sequence so…

A: Cell is an elemental unit of the body in wh ch various types of metabolic activity are performed .…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then…

A: Transcription is the process by which genetic information encoded in DNA is copied into a…

Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Which nucleotide is most non-polar and why? What structural element of DNA gets cleaved by…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: 1. The histones that form the tetrasome.        2. The histones added to the tetramer to form the…

A: Histones are proteins responsible for DNA packaging, they are positively charged and so can easily…

Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…

A: DNA replication is the process of production of identical copies of DNA molecules with the help of…

Q: 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger…

A: Since there are multiple questions in this particular question, I'll answer the first one for you.…

Q: To study the chromatin structure of PIND, muclei from NIH3T3 cells and human growth hormone- treated…

A: DNAse 1 is an endonuclease with minimal sequence specificity. It can cleave both single-stranded and…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: PART 1: DNA STRUCTURE Nucleotides are the building blocks of nucleic acids (RNA and DNA). 1. On the…

A: Introduction  DNA (Deoxyribonucleic acid) is a molecule that carries genetic information in cells.…

Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…

A: DNA is the genetic material in living organisms. It carries instructions for making structural and…

Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…

A: Nucleic acid is chemically different than protein and carbohydrate . This difference  helps in…

Q: Which one is correct about telomeres? Choose at least one correct answer TTAGGG sequence is…

A: The distinctive structures that are found at the ends of our chromosomes and  consist of the…

Q: Imagine you were asked to extract DNA from the cells of another plant species. Choose 3 species of…

A: DNA extraction from plant tissues is easier compared to animal tissues. Everyday items like shampoo,…

Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?

A: DNA is the store house of genetic information. This genetic information expressed by the formation…

Q: HORSE: Use your translated amino acid sequences to determine the phenotypes to include in your…

A:

Q: slation The following is the base sequence of an exon portion of a template strand of a DNA…

A: In this question we are provided with information regarding DNA template strand and we have to find…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure…

A: DNA It is a biomolecule that carries genetic information and information for the process of protein…

Q: DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5? What is…

A: Central dogma, is  a process by which genetic information is being transferred from DNA to protein…

Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…

A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: DNA TRANSCRIPTION TRANSLATION REPLICATION (D) DNA template (B] 3'-5' (C) MRNA (E) New (F) Name of…

A: Transcription is the process of synthesizing an RNA by the action of a DNA dependent RNA Polymerase.…

Q: DNA plays an important role in two processes. During the process of replication, dna provides…

A: DNA A polymer made of two polynucleotide chains that coil around one another to form a double helix…

Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…

A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…

A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…

Q: Instructions: Provide brief answers to the following questions: 1. How many codons are there in the…

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: atch the substance to It's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v…

A: Prevents supercoiling: B.topoisomerase Unwinds and separate ds DNA:F.helicase Adds a short piece of…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: (i) Will the primer anneal to the upper strand or the lower strand in the diagram? Draw the primer…

A: In linear DNA of eukaryotes without a special mechanism for replicating the ends, chromosomes would…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.