representation of DNA replication. Complete your representation for a single helical turn. 2.  prepare a representation of how mRNA is formed in the nucleus  3.  Complete to build a Polypeptide. Start from the DNA template you made , the mRNA transcript formed, and finally the processed or synthesize

Q: 3c. there are three enzymes that go by the name of DNA polymerase 1 2 and 3. please describe the…

A: DNA polymerase helps in the synthesis of new strand of DNA. DNA polymerase is present in both…

Q: 5. Consider the following DNA template strand: 3’ GCA- AAA-CAA-ATA-GTG 5’ Using the following…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…

A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: Below is a coding strand of DNA. Assume the transcription start site is outside of this sequence so…

A: Cell is an elemental unit of the body in wh ch various types of metabolic activity are performed .…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 2. For the DNA molecule shown below, the 5' Strand of DNA is transcribed into mRNA and then…

A: Transcription is the process by which genetic information encoded in DNA is copied into a…

Q: Which nucleotide is most non-polar and why? What structural element of DNA gets cleaved by…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: 1. The histones that form the tetrasome.        2. The histones added to the tetramer to form the…

A: Histones are proteins responsible for DNA packaging, they are positively charged and so can easily…

Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…

A: DNA replication is the process of production of identical copies of DNA molecules with the help of…

Q: To study the chromatin structure of PIND, muclei from NIH3T3 cells and human growth hormone- treated…

A: DNAse 1 is an endonuclease with minimal sequence specificity. It can cleave both single-stranded and…

Q: PART 1: DNA STRUCTURE Nucleotides are the building blocks of nucleic acids (RNA and DNA). 1. On the…

A: Introduction  DNA (Deoxyribonucleic acid) is a molecule that carries genetic information in cells.…

Q: 1. This image summarizes how computers sort and order DNA fragments to produce a final sequence of…

A: Nucleic acid is chemically different than protein and carbohydrate . This difference  helps in…

Q: How many codons are there in the mutated DNA - (b) and DNA - (c)?

A: DNA is the store house of genetic information. This genetic information expressed by the formation…

Q: HORSE: Use your translated amino acid sequences to determine the phenotypes to include in your…

A:

Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to…

A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA…

Q: slation The following is the base sequence of an exon portion of a template strand of a DNA…

A: In this question we are provided with information regarding DNA template strand and we have to find…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: I need help with a microbiology question from my study guide. The question involves DNA sequencing.…

A: mRNA sequence transcribed from the given template (antisense) is:   3'-A U G A C U G A C U G C U A G…

Q: 6. Do you think scientists would extract human DNA the same way you extracted fruit DNA? Explain.…

A: The DNA extraction is the method by which the DNA is taken out from the nucleus of the cell by…

Q: DNA replication Transcription Polymerase moves along DNA template from 5' to 3' or 3' to 5? What is…

A: Central dogma, is  a process by which genetic information is being transferred from DNA to protein…

Q: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester…

A: DNA is Nucleic acid that consists of two strands that run in opposite directions. One of the stand…

Q: Yhich amino acid is considered to be hydrophilic? a. Methionine b. Alanine c. Glycine d. Threonine

A: Hydrophilic amino acids are those acids which are highly stable when present in water. They are…

Q: 1. Describe the process of autophosphorlyation 2. Differentiate between chromosomes and genes. 3.…

A: Autophosphorylation is a process by which a protein kinase enzyme phosphorylates its own tyrosine or…

Q: DNA plays an important role in two processes. During the process of replication, dna provides…

A: DNA A polymer made of two polynucleotide chains that coil around one another to form a double helix…

Q: 8. Helps RNA polymerase recognize and bind the promoter. 9. Assemble the 30S, 50S ribosome, mRNA and…

A: The production of new DNA from the old DNA is known as replication. The production of RNA from DNA…

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: Instructions: Provide brief answers to the following questions: 1. How many codons are there in the…

A: Note: As Per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: atch the substance to It's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v…

A: Prevents supercoiling: B.topoisomerase Unwinds and separate ds DNA:F.helicase Adds a short piece of…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 4. During DNA replication, half of the strand is conserved in the new molecules created. This is…

A: 4. During DNA replication, half of the strand of conserved in the new molecules created. This is…

Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: Mention and explain 4 characteristics of the Structure of DNA.

A: DNA- Deoxyribose Nucleic Acid

Q: Mama: ‏Compare and contrast the major similarities / differences between DNA synthesis on a leading…

A: DNA replication is the process where production of two identical copies of DNA from one original…

Q: 1. In the Central Dogma, what process involves the production of a new DNA strand using an old DNA…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: . DNA synthesis begins at specific nucleotide sequences, called leading strand, and proceeds in…

A: False  DNA synthesis starts at a specific place on a chromosome called an origin of replication.It…

Q: Discuss DNA replication (eukaryotic)  based on your own understanding of the process. Make sure to…

A: Eukaryotic DNA replication is a highly specialised mechanism involving replication of eukaryotic DNA…

Q: 13. A particular template strand of DNA has the sequence listed below: 3' G C A G A T A A T C 5' а.…

A: Template and coding strand are two different strands of DNA, in which template strand act as base…

Q: 1. Below is the sequence from the 3' end of an mRNA.…

A: Genes store genetic information in the form of DNA, which may be converted into functional proteins…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.