Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase codon primer aminoacyl TRNA synthetase antisense strand helicase single stranded binding proteins DNA gyrase peptidyl transferase primase RNA polymerase
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Another…
A: Asked: Another term for template strand in transcription
Q: The following sequence of nucleotides is found in a single-stranded DNA…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: DNA ( deoxyribonucleic acid ) is the hereditary material in humans and almost all other organisms.…
Q: Normal sequence: DNA: MRNA: GGA CCU prline CTC GAG glutamic acid CTC GAG glutamic acid Amino Acids:…
A: Normal sequence: DNA: GGA CTC CTC mRNA: CCU GAG GAG Amino Acids: proline glutamic acid glutamic…
Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…
A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…
A: To identify: The mutation in the given DNA sequence
Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…
A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…
Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…
A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…
Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…
A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of…
Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…
A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: COMPLEMENTARY
A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below
Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…
A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…
Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…
A: DNA serves as the genetic material and carries genetic information from one generation to another.…
Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…
A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…
Q: cleotides nucleus adenine cytosine…
A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…
Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…
A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…
Q: RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of…
A: During the process of transcription. RNA polymerase is the enzyme and its main function is to…
Q: Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase…
A: DNA is a genetic material that uses transcription and translation to transfer genetic information to…
Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…
A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…
Q: AKS 5c1: The process represented in the model involves the creation of a molecule that is…
A: Transcription is a process that helps convert the information in the DNA strand into RNA in the…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino…
A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…
Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…
A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…
Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…
A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…
A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: Why is it important that the correct reading frame is used?
A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process by which a single DNA strand will produce two identical daughter…
Q: How many subunits does the E. coli DNA polymerase I have? Soloct onot
A: Option(d) 1
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…
A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…
Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…
A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.
Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A
A: The DNA is the genetic material that is responsible for the production of RNA transcription process.…
Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…
A: CODONS 3 4 5 6 7 8 9 NORMAL PRO THR VAL THR THR ARG TRP CODON CCC ACG GUG ACG ACA CGG UGG…
Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…
A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…
Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…
A: DNA replication is the process of generating two identical copies from the original DNA strand. The…
Q: Draw a DNA helix opened up to copy a single gene (CAREFUL this is NOT a replication bubble). You can…
A: Transcription is the first of several steps of DNA based gene expression in which a particular…
Q: Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…
A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…
Q: Translate the protein that is expressed from this template DNA sequence. Transcription is going left…
A: Transcription is the process of formation of mRNA from a DNA transcript. It occurs ont he template…
Q: A Section of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the…
A: \protein synthesis in a cell is a very important function. The information for protein synthesis is…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Order of bases in DNA Order of bases in MRNA Order of basea in tRNA (anticodon) Amino acid coded…
A: DNA molecules are the carriers of genetic information in nucleus of a cell. The DNA undergoes the…
Q: Use your codon chart to determine the amino acid sequence. Remember to read through the strand and…
A: Transcription is the process of copying information present in the DNA to RNA. The information…
Q: 16. Translation codon termination in eukaryotes all except: B. UGA A. UAC C. UAG D. UAA
A: introduction Translation is the process of creating polypeptides from an mRNA transcript that was…
Q: DNA Replication Transcription No Answers Chosen No Answers Chosen Translation Common to all three No…
A: The mechanism by which a double-stranded DNA molecule is replicated to create two equivalent DNA…
![function/role:
Adds nucleotides in in the 5' to 3' direction during transcription.
[ Select ]
[ Select ]
ligase
codon
primer
aminoacyl tRNA synthetase
antisense strand
helicase
single stranded binding proteins
DNA gyrase
peptidyl transferase
primase
RNA polymerase
sliding clamp
DNA polymerase I
sigma factor
DNA polymcrasc III](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F0ebba1cb-7b8d-4edb-a729-eb45140da03b%2F6857586d-7a7a-4443-a23f-956f78b02cbe%2Fycrdhhe_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps
- Arg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- Match the components of bacterial replication and transcription correctly. v [Choose ] Topoisomerase Il helicase loader RNA polymerase must accumulate enough for DNA replication to begin Single stranded binding protein sigma factor proteins of the RNA polymerase adds nucleotides to RNA transcript DnaA bacterial helicase DNA gyrase - needed for recognition of promoter site in transcription Beta clamp DNA polymerase Tau complex two alpha units, beta, beta prime, and omega Dnac [ Choose ) DnaB ( Choose]RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed
- me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3' UUUCCUCAA 5' code for? RNA Codon Chart 31 Alanine G U A Tyrosine Stop Valine A G Cysteine U 3' U G Stop G Tryptophan 3' G 5' Arginine G U A Leucine Serine A Lysine A U Proline G Asparagine leucine-threonine-glutamic acid asparagine-serine-phenylalanine serine-histidine-glutamine phenylalanine-proline-histidine phenylalanine-proline-glutamine Serine Glutamic acid Aspartic acid Histidine Glutamine Arginine Isoleucine 2 Threonine Methionine Q#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
