For each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence). Process most immediately affected by deletion RNA Sequence deleted Replication Transcription Translation processing a. ori site b. 3' splice site consensus c. Poly(A) tail d. Terminator e. Start codon f. -10 consensus g. Shine-Dalgarno

For each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence). Process most immediately affected by deletion RNA Sequence deleted Replication Transcription Translation processing a. ori site b. 3' splice site consensus c. Poly(A) tail d. Terminator e. Start codon f. -10 consensus g. Shine-Dalgarno

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Which of the following are stages of translation? Select all that apply. a.As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. b.A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. c.When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. d.Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA. e.The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon.
1c) Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.
Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize mRNA containing A's and G's only (poly-AG in random order). 2. Convert the amino acid Glutamic acid (Glu) on its tRNA to the amino acid Glutamine (Gln) as shown below. 3. Mix your poly-AG RNA, your artificial tRNA, and cell extract (contains ribosomes, amino acids, all normal tRNAs, and the energy source for translation). Phe Tyr GAA GAA Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG. What does the outcome of this experiment tell us about translation? Multiple codons code for each amino acid. An amino acid is selected based on the identity of the tRNA. The ribosome does the translation, i.e. it selects the amino acid regardless of the identify of the tRNA. The ribosome reads mRNA 3 bases at a time.
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
Below is an electron micrograph illustrating the process of simultaneous transcription and translation in a prokaryotic cell. Use this illustration to answer the question. A. Which of the following statements is correct? 1. The direction indicated by A, is the correct direction of RNA polymerase movement. 2. If C and D are both pointing to the first ribosome in the chain, then ribosome C is carrying a longer polypeptide chain. 3. If E is pointing to mRNA, then it is pointing to the 5'end of the mRNA. 4. If B is pointing to the DNA, then it is pointing to the 5' end of the DNA. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and4 O D. 4 only O E. All of 1, 2, 3 and 4 are correct
Find the sequence of the mature RNA that would be formed following the next instructions: 1. Add a Guanin before the first nucleotide transcribed 2. Splice the RNA sequence 4 nucleotides upstream of the consensus splicing sequence (AAUAAA in blue). Remove all nucleotides downstream of the splicing site and then add 5 Adenines right after the splicing site. This will be the poly A tail. 3. Remove the corresponding intron and bind both exons. Write the sequence obtained below (all in capital letters)
2b) What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?
During the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using polyadenylate polymerase b. The spliceosome breaks covalent bonds at 5' and 3' splice sites c. A 5'methyl cytosine cap is added using specific enzyme d. A 3'-poly-A tail is attached using an unusual 5'-5 ester linkage
Complete the following sentence: Transcription of DNA by RNA polymerase II synthesises microRNA precursor transcript in: A. either the 3′ to 5′ direction or the 5′ to 3′ direction depending on the orientation of the gene B. a discontinuous fashion. C. the 3′ to 5′ direction. D. both the 3′ to 5′ direction and the 5′ to 3′ direction simultaneously E. the 5′ to 3′ direction.
Find the events from prokaryotic translation from the list below and list them below in order, by letter, from earliest to latest during translation A. Incoming tRNA occupies the A-site B. Small ribosome binds to Shine Dalgarno sequence C. 5’ methyl cap binds small ribosome D. Large ribosome subunit binds the small ribosome subunit E. P-site tRNA peptide is attached to the amino acid of the A-site tRNA. F. f-Met tRNA binds to P site G. Small ribosomal subunit binds mRNA H. Peptide released from complex.
Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'
The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. A, P, and E sites