Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.4. Differentiate replication, transcription and translation by describing the changes which occur in each process.

Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.4. Differentiate replication, transcription and translation by describing the changes which occur in each process.

Name: Show the structure of a DNA where the lead strand is ATCG. Show H-, gl
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.4. Differentiate replication, transcription and translation by describing the changes which occur in each process.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter6: Metabolism

Section: Chapter Questions

Problem 5RQ: DNA replication involves unwinding two strands of parent DNA, copying each strand to synthesize...

See similar textbooks

Similar questions

Which of the following is part of the elongation step of DNA synthesis? pulling apart the two DNA strands attaching complementary nucleotides to the template strand untwisting the DNA helix none of the above
DNA replication requires _______. a. DNA polymerase b. nucleotides c. primers d. all are required
DNA replication involves unwinding two strands of parent DNA, copying each strand to synthesize complementary strands, and releasing the parent and daughter DNA. Which of the following accurately describes this process? This is an anabolic process This is a catabolic process This is both anabolic and catabolic This is a metabolic process hut is neither anabolic nor catabolic.
Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from_______. a. ATP b. DNA polymerase c. the nucleotide d. a and c
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.
3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC
8. Shown below is a DNA strand. 5' GACGTACTACGACTATGGC 3' What is the correct representation of its complementary strand?
(3) A DNA strand is 5' TAC ACG GTC TAA3' Write the RNA strand that could be made from the DNA strand. Indicate the 5' and 3' ends
5. Know the enzymes involved in DNA replication, and predict the result of their malfunctioning. PART 1: DNA STRUCTURE Nucleotides are the building blocks of nucleic acids (RNA and DNA). 1. On the nucleotide schematic below: A. label the phosphate group, the nitrogenous base, and the pentose (5-carbon sugar). B. Label the carbon atoms in the sugar ring from 1 to 5. 0-²-0-²-0-- hon t ori s H I. -H N 'N od isnw begee 976 eb H 10 BA C. What functional groups on ANY nucleotide can tell you whether it is a component of DNA or RNA? D. Which carbon # is this functional group bound to? E. What functional group does the 3' on DNA represent? F. What functional group does the 5' on DNA represent? 18 47
1. Which protein and nucleic acid molecules are present in the PDB structure with code IKX3? Histones 2A and 2B and DNA only. DNA only. Histones 3 and 4 and DNA only. Histones 2A, 2B, 3, 4 and DNA. DNA ligase. 1. 2. 3. 4. 5. Which amino acids would you expect to find buried in the interior of peripheral membrane protein? 1. leucine, methionine 2. threonine, glutamate tyrosine cysteine 3. 4. 5. lysine, arginine histidine, glutamic acid A basic leucine zipper 1. 3 is the name of a full transcription factor protein. interacts with RNA polymerase. is a portion of a full transcription factor protein. is used to join any type of protein domains. cause aggregation of transcription factors. 4 DNA methylation acts to inhibit gene expression by 1. altering the DNA structure and interfering with proteins that bind. changing binding of histones to DNA. 3. activating the binding of bromodomain containing proteins. 4. 2. forming acetyl groups. changing the TATA box sequence. 5. A-2345 2.
H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image? 2. What are the bases that are part of the magenta strand in green plane? (A,T,G,C,U)?