7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant form are shown. By consulting Table 3-1 in your textbook, determine the double-stranded sequence of the corresponding section of the normal gene. Which strand is the strand that RNA polymerase "reads" and copies? What wo the sequence of the resulting mRNA be? What kind of mutation is the mutant protein most likely to represent? Normal -lys-arg-his-his-tyr-leu- Mutant 1 -lys-arg-his-his-cys-leu- Geneticists are studying a malfunctioning protein that causes impaired endothelial ce migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated MRNA strand is isola and analysis shows a mutation located near the 3' end of the coding region. The 3'

7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant form are shown. By consulting Table 3-1 in your textbook, determine the double-stranded sequence of the corresponding section of the normal gene. Which strand is the strand that RNA polymerase "reads" and copies? What wo the sequence of the resulting mRNA be? What kind of mutation is the mutant protein most likely to represent? Normal -lys-arg-his-his-tyr-leu- Mutant 1 -lys-arg-his-his-cys-leu- Geneticists are studying a malfunctioning protein that causes impaired endothelial ce migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated MRNA strand is isola and analysis shows a mutation located near the 3' end of the coding region. The 3'

Name: 7. The following amino acid sequence represents part of a protein. Th
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 7. The following amino acid sequence represents part of a protein. The normalsequence and a mutant form are shown. By consulting Table 3-1 in your textbook,determine the double-stranded sequence of the corresponding section of the normalgene. Which

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic…

A: DNA is the genetic material in living organisms. It carries instructions for making structural and…

Q: DNA molecules consist of chemically linked sequences of the bases adenine, guanine, cytosine, and…

A: Codon is a base triplet that exists in DNA. DNA gets transcripted to mRNA which then translates to…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…

A: CODONS 3 4 5 6 7 8 9 NORMAL PRO THR VAL THR THR ARG TRP CODON CCC ACG GUG ACG ACA CGG UGG…

Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…

A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…

Q: Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts.

A: When an RNA transcript is first made in a eukaryotic cell, it is considered a pre-mRNA and must be…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: What is the sequence of the mRNA transcript that will be produced from the following sequence of…

A: Transcription is the process of synthesis of RNA from DNA. RNA polymerase catalyzes this process by…

Q: 10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence…

A: 1. The genetic code is the set of rules followed by cells to read and translate the genetic…

Q: A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin;…

A: Introduction Peptides Are Short Sequences of Amino Acid Monomers Joined by Amide Bonds That Occur…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…

A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…

Q: Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

7. The following amino acid sequence represents part of a protein. The normal
sequence and a mutant form are shown. By consulting Table 3-1 in your textbook,
determine the double-stranded sequence of the corresponding section of the normal
gene. Which strand is the strand that RNA polymerase "reads" and copies? What would
the sequence of the resulting mRNA be? What kind of mutation is the mutant protein
most likely to represent?
Normal -lys-arg-his-his-tyr-leu-
Mutant 1 -lys-arg-his-his-cys-leu-
Geneticists are studying a malfunctioning protein that causes impaired endothelial cell
migration and angiogenesis. They have noticed that the amino acid sequence of the
protein is truncated compared to normal controls. The mutated mRNA strand is isolated,
and analysis shows a mutation located near the 3' end of the coding region. The 3'
terminal coding sequence of the abnormal mRNA strand is shown below.
5-...-AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-
GGC-GGA-AAA-UUU-UAA-3
Using this sequence, can you explain a probable cause for the protein malfunction?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.
2 a) The following nucleotide sequence is found on the template strand of DNA: 3-TAC TGG CCG TTA GTT GAT ATA ACT-5" Determine the amino acids of the encoded peptide, then provide the altered amino acid sequence of protein that would result from each of the following mutations and provide their classification (eg. Missense, nonsense, etc). 益券 A transition at nucleotide 11 A transition at nucleotide 13 A one-nucleotide deletion at nucleotide 7 AT to A transversion at nucleotide 15 An addition of TGG after nucleotide 6 A transition at nucleotide 9
In your own words