10. A portion of5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this codefor? To answer the question please:I) explain what is the genetic code and list the properties of the genetic e2) draw a diagram of protein synthesis;3) determine which tRNA should be attached to the mRNA;4) what is the anticodon for the very first tRNA that will attach to mRNA?mRNA molecule has the sequencean

1. The genetic code is the set of rules followed by cells to read and translate the genetic…

10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: 1) explain what is the genetic code and list the properties of the genetic code; 2) draw a diagram of protein synthesis;

10. A portion of an mRNA molecule has the sequence 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: 1) explain what is the genetic code and list the properties of the genetic code; 2) draw a diagram of protein synthesis;

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: . Code the following mRNA strand into amino acids AUGUGUCGGGACACAUAA

A: Introduction An amino acid is any organic acid that has an alpha carbon atom which is attached to an…

Q: 15. The following is a list of some mRNA codons representing various amino acids. Met-AUG, Pro -…

A: The genetic code is the set of rules by which information encoded within genetic material,…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: How would you choose where to begin your reading of a sequence in mRNA? Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: 2. A molecule of tRNA with the anticodon 5'-ACC-3' will transport the amino acid the tRNA and the…

A: The genome is the genetic material of an organism that is passed down to its descendants and can be…

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: 1) Describe the dna transcription-mRNA with all the step.

A: The discovery of DNA as genetic material is one of the most significant discoveries in molecular…

Q: If the sequence of the coding strand in a transcription unit is written as follows: 5'-…

A: In that question we have to write down the sequence of mRNA.

Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…

A: DNA replication, transcription, and translation are the molecular processes that are responsible for…

Q: Identify the major types of RNA in a cell and discuss their individual functions in relation to…

A: ACCORDING TO BARTLEBY GUIDELINES, I CAN ONLY ANSWER ONE QUESTION. KINDLY POST THE REMAINING QUESTION…

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: True or false for these statements: a. ubiquitin molecule signals that a protein is ready to be…

A: Proteosome is barrel saved complex structure, contain high amount of structure that is responsible…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 1. What mRNA sequence does the following DNA template sequence produce? DNA…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *

A: Amino acids production.

Q: Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA,…

A: The synthesis mRNA from double-stranded DNA requires the enzyme RNA polymerase II, this enzyme will…

Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…

A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.

Q: 3. Label the illustration below using the following terms: DNA, MRNA, codon, transcrip translation,…

A: All the living organisms contain genetic material. The genetic material is responsible for passing…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The AUC and AUA codons in mRNA both specify isoleucine. This feauture of the genetic code explains…

Q: Build the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly letter by…

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false

A: The translation process is by which organisms forms protein or a polypeptide chain.

Q: 1. Create a DNA sequence with eighteen nucleotides. Indicate its 3’ on the left and 5’ on the right…

A: Three parts are solved in case of interlinked question as per our company policy. If you want…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: The cells are the basic biological structural and functional units of life. These cells of the body…

Q: Given the mRNA sequence ,5’-AUGUACAAGGUCGGAUGA-3’ which of the following amino acid sequence would…

A: The objective of the question is to determine the sequence of amino acids that would result from the…

Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…

A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 46.Describe briefly the functions of the three types of RNA (tRNA, mRNA and rRNA) in protein…

A: Transcription the process of making RNA copy from DNA. Translation is the process of making proteins…

Q: Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Put the following events in the synthesis of a polypeptide in the proper order. An initiator tRNA…

A: Ribosomes are the made of RNA and proteins. During translation m RNA is processed in the ribosome…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

#29 and #30
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)
Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the basic unit of the code relating DNA to protein?
What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC (assume transcription is from left to right)? Indicate clearly the 5' and 3' ends of your transcript. 5'-GAUGUUUAC-3' 5'CUACAAAUG-3' 5'-CAUUUGUAG-3' 5'GUAAACAUC-3
The first nucleotide in mRNA that will be synthesized from DNA below is: 3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'
Mm.10. Subject:- Chemistry
The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence of the DNA coding strand? Of the DNA template strand?
For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?
1. Draw a line representing mRNA that has already been processes (introns removed, cap and tail added). Label the 5' cap on left end and polyA tail. 2. An inch from the left add the start codon (AUG). 3. An inch from the right add one of the three stop codons. 4. Label the 5' UTR and 3' UTR (untranslated regions). 5. In the middle of your mRNA, draw two ovals representing the large and small subunits of the ribosome bound to the mRNA. Make these large enough that you can add the details below. In between the two subunits indicate the ribosomal A, P and E sites in the correct place. Put an arrow on top of ribosome to show direction of translation 6. Draw at least 3 tRNA on your picture in the correct locations: an empty one (no amino acid) exiting the ribosome, a charged tRNA with a small circle on the 3' end to indicate an amino acid, and a tRNA with several small circle representing amino acids in a chain (polypeptide). 7. Indicate the amino end of polypeptide with an “N”. (Remember…
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α