Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events.  a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid  ) is a…

Q: There are dozens of common variations of the c-myc gene, which are associated with different types…

A: The mRNA is produced from the DNA by the transcription process and this mRNA is used for the protein…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found…

A: DNA is the genetic materials of all most all eukaryotes and prokaryotes. RNA is genetic materials of…

Q: Discuss the two steps involved in RNA processing. Please explain each step in 2-3 sentences only.

A: In Eukaryote, mRNA produced during the transcription process is known as pre-mRNA. They undergo…

Q: Please answer the following questions: 1. What is the role of MinC, MinD, and MinE in bacterial cell…

A: As per bartleby guidelines, only first three questions can be answered. Please post the remaining…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino…

A: In a DNA sequence, Intron is the non coding portion and exon is the coding portion. After splicing…

Q: A). What is the amino acid sequence of the polypeptide produced from a eukaryotic gene that has the…

A: Transcription  The process on making mRNA from DNA which further get translated into polypeptide…

Q: A. The diagram below shows a tRNA molecule. X Y Z. (i) Which part of a cell is the tRNA produced?…

A: Disclaimer: Since you have posted a question with multiple sub-parts, we will solve the first 3…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: What is meant by the term cDNA, and how may a cDNA differ from the gene from which it is derived?…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other animals.…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Describe the mRNA journey through the cell after the nucleus has given the instructions.  Describe…

A: The information contained in a gene's DNA is transferred to an analogous molecule called RNA…

Q: lentify the various types of DNA repair mechanisms known to counteract the effects of UV Padlatloh.…

A: Photoreactivation repair- It is the recovery of ultraviolet irradiated damages of DNA by visible…

Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…

A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…

Q: B. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…

A: Introduction DNA resides in the sequence of four nucleotides. The genetic code is a triplet code…

Q: (b) How many forms can naturally occurring DNA exist in? Explain how these forms are characterized.…

A: DNA  Deoxyribonucleic acid  Genetic material in many species Has ds(double stranded) structure…

Q: Please read the scenario below and then answer the question (in bold) that follows. An original DNA…

A: The original DNA sequence is  3'-GGCGCTAGAATC-5'. A mutated version of that DNA strand is…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 16)(comprehension) Suppose the following DNA sequence was mutated from 3'-AGAGAGAGAGAGAGAGAG-5' to…

A: The central dogma states that DNA undergoes transcription to form mRNA which then gets translated to…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of…

A: Replication It is defined as the process in which the DNA duplicates into another copy which is…

Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…

A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors,  The…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Questions 19-22: Based on the information presented above (and relevant info from your textbook,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.