Date: Class: Name: Transcription Questions Answer the following questions. 1. What bases are found in RNA? 2. What bases are found in DNA? 3. Which strand is the messenger RNA complementary to? 4. Which strand is the messenger RNA nearly identical to? 5. What proteins help to direct the RNA Polymerase to the right location? 6. The end of a new nucleotide is always added to the end of an existing strand. 7. Distinguish between the following two terms: chromosome and gene. 8. Scientists have long referred to the DNA between genes as "junk DNA". But as scientists study the they discover new and unique reasons why this DNA is not really "junk". Using internet resources, research 2 functions for sections of DNA in between genes. Describe your findings below. genome,

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…

A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…

Q: Questions 19-24: Gene structure/Splicing problem. “Protein X" consists of a total of 431 amino…

A: In a DNA sequence, Intron is the non coding portion and exon is the coding portion. After splicing…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: Which of the following types of mutations, resulting in a change in the mRNA just after the…

A: The translation process will result in the creation of proteins. The process of protein synthesis is…

Q: Describe the process of translating mRNA into proteins. Be sure to also include the following key…

A: The translation is known as a process in which protein is synthesized through the mRNA (transcribed…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: (b) How many forms can naturally occurring DNA exist in? Explain how these forms are characterized.…

A: DNA  Deoxyribonucleic acid  Genetic material in many species Has ds(double stranded) structure…

Q: The diagram below shows the normal sequence of a particular protein, along with several mutant…

A: Original Sequence: Met Gly-Glu-The-Lys-Val-Val- -ProMutant Sequence: Met-GlyMutation Description: In…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: The diagram shows prokaryotic transcription. The DNA is shown in red and blue, the RNA is shown in…

A: The 3' end of the RNA strand is indicated by letter F.The 3' end of the lower DNA strand is…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: b. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of…

A: Replication It is defined as the process in which the DNA duplicates into another copy which is…

Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…

A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: Questions 19-22: Based on the information presented above (and relevant info from your textbook,…

A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Make up a DNA sequence of at least 18 nucleotides and then (2) show the mRNA sequence that will be…

A: mRNA  A sequence of ribonucleic acid bases that is made up from DNA by the process of transcription.

Q: GIVE A SHORT ANSWERS TO QUESTIONS GIVEN BELOW  Why Phosphate bond is important in DNA or RNA…

A: Phosphate bond are important because structural framework of nucleic acid the energy for producing…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.