Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA C T A T T G A C C G G C MRNA 6. What is the name of the enzyme which catalyzes this reaction? 7. What three things must then happen to the pre-MRNA you just synthesized before it is allowed to exit the nucleus? 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time to transcribe the mRNA. You may use the abbreviations for the amino acids found in Figure 15.8 of your textbook

Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA C T A T T G A C C G G C MRNA 6. What is the name of the enzyme which catalyzes this reaction? 7. What three things must then happen to the pre-MRNA you just synthesized before it is allowed to exit the nucleus? 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time to transcribe the mRNA. You may use the abbreviations for the amino acids found in Figure 15.8 of your textbook

Name: Synthesize a Protein5. Below is a region of a gene. Transcribe the ge
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Synthesize a Protein5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.DNAMRNAGCCGTA6. What is the name of the enzyme which catalyzes this reaction?7. What three things must then happen to the pre-MRNA you just synthesized be

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they would occur during pre-mRNA processing in eukaryotes. Pre-MRNA Exon 1 Intron Exon 2 Pre-MRNA processing MRNA Exon1 Exon 2 AAAAA 3 Export to cytoplasm Translation Recognition and binding the 3' AAUAAA sequence by specific proteins Attachment of snRNP U1 to the 5' splice site Formation of a bond between the guanine in the 5' splice site and the adenine of the branch point Binding of the snRNP U4, U5 and U6 complex to the spliceosome Addition of the 5' cap Release of the intron as a lariat structure and splicing of exon 1 and 2 Addition of the poly(A) tail Binding of snRNP U2 to the branch point Cleavage at the poly (A) site
1. Given the piece of MRNA: 5'-CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC-3' 1. Predict the DNA strand sequence from which it was transcribe 2. List the complementary non-coding DNA Sequence 3. List the Amino acid Sequence of the protein coded for. Use the Genetic Code 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA. 5'- TACCATGAGAATTGTGG TCACCTTTTT-3' 3'- ATGGTACTCTTAACACCAGTGGAAAA A-5' MRNA Sequence Amino Acid Sequence
10
What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would be synthesized from the gene. In each of the available line you should transcribe all nucleotides that form the immature mRNA. If the sequence indicated is not transcribed then write NA. WRITE THE NUCLEOTIDES IN CAPITAL LETTERS. Promoter: EXON 1: Intron 1: Exon 2: Intron 2: Exon 3 without terminator : Exon 3 terminator:
Why can introns be of any length? 2. Why are the individual exons not in multiples of 3 but yet their total length is a multiple of 3? 3. Below is a mRNA that contains a cap and tail. What is the resulting amino acid sequence? 5’GGGGGGGGCGAAGAUUGAUGACUAGAAAUUGGGAUCCUACGUGAGAAGGUGUGAAAAA AAAAAAAAAA3’
Please help with this genetic mutation problem (cellular bio)
Date: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial transcript called? 2. What is the final messenger MRNA called? 3. What two things are added to the messenger RNA? 4. What fragments are removed from the messenger RNA? 5. Why are the poly A tail and methyl G cap important? 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA (C) 2015 Bethany Lau.
Explain all options. Which option is correct and why ?? Asap
Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: | Amino Acid Sequence: Mutated DNA Sequence #1: T A C A T C T T G G C GAC GA C T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence? . Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #2: T A C G AC C T T G G C G A C G AC T What's the mRNA sequence? (Circle the change) What will be the amino acid sequence?. Will there likely be effects?. What kind of mutation is this? Mutated DNA Sequence #3: T A C A C C T T A G C GAC GA C T What's the mRNA sequence? (Circle the change). What will be the amino acid sequence?. Will there likely be effects? | What kind of mutation is this? Mutated DNA Sequence #4: T A C A C C T T G G C GACTAC T What's the mRNA sequence? (Circle the change), What will be the amino acid sequence?. Will there likely be effects? - What kind of mutation is this? Mutated DNA Sequence #5: T A C A C C T T G G G A C…
First Position (5'-end) U C A U UUU Phe UUC Phe UUA Leu UUG Leu G CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG* Met GUU Val GUC Val GUA Val GUG Val с UCU UCC UCA UCG Ser Second Position A CCU Pro CCC Pro CCA Pro CCG Pro ACU ACC Ser Ser Ser Thr Thr ACA Thr ACG Thr GCU GCC Ala Ala GCA Ala GCG Ala *AUG also serves as the principal initiation codon. G UAU Tyr UGU UAC Tyr UGC UAA Stop UGA UAG Stop UGG CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA AAG GAU Asp GAC Asp GAA Glu GAG Glu CGU Arg CGC Arg CGA Arg CGG Arg Lys AGA Lys AGG Cys Cys Stop Trp AGU Ser AGC Ser GGU GGC Arg Arg Gly Gly GGA Gly GGG Gly Third Position (3'-end) DOAG DOAG U C U C DOAG DOAG U C U C
#6
9