Part 1: transcription (DNA- mRNA) 1. You are now inside of a cell, looking at a strands of DNA. Look at the region of DNA labeled “Gene 1” What do you think of the role that each region

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: 1. corrected DNA sequences 2.mRNA sequence 3. Amino acid sequence and description 4. Drawing of…

A: The gene is the sequence of DNA which carry information to code for a specific protein or functional…

Q: 5. The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the…

A: Solution: the required labelled image is provided in the image attached below:

Q: Gene transcription is a complex process that involves specific interactions of proteins and…

A: Transcription is a part of gene expression. In this process RNA is synthesized with the help of…

Q: What stops the translation process? when a stop codon on the mRNA enters the A site when a stop…

A: There are three types of stop codons which are present in m RNA and when they are encountered the…

Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…

A: In species, gene expression is a vital and essential process that helps to produce proteins by using…

Q: Below is a coding strand of DNA. Assume the transcription start site is outside of this sequence so…

A: Cell is an elemental unit of the body in wh ch various types of metabolic activity are performed .…

Q: 3.What could mutation m1 do to the rate of transcription? Increase? Decrease? Have no effect?…

A: Introduction The process of converting a piece of DNA into RNA is known as transcription. Messenger…

Q: Question 2. What recruits the enzymes that form the 7-methylguanosine 5'cap on the hnRNA/primary…

A: A single-stranded RNA molecule known as mRNA or messenger RNA. It is a complimentary molecule to DNA…

Q: 8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA…

A: Gene expression is a process in which first transcription occurs that is formation of RNA occurs…

Q: You are a scientist studying muscle cells. You are interested in making all of the muscle cells of a…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: 5. You're working in Marshall Nirenberg's lab, trying to decipher the genetic code. You use several…

A: Introduction Marshall Nirenberg discovered a way to determine the sequence of the letters in each…

Q: 6. How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce? (LS1-1) * Second MRNA…

A: The translation is the process by which the information on the mRNA is transferred into appropriate…

Q: 11

A: Probably the earliest reference to age-related mental inadequacy is ascribed to Pythagoras in the 7P…

Q: HORSE: Use your translated amino acid sequences to determine the phenotypes to include in your…

A:

Q: II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG…

A: Introduction Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: "Gene expression is essential to keeping a cell alive. I want to see either transcription OR…

A: Transcription is the process by which DNA is copied to RNA. RNA is a single-stranded molecule that…

Q: 1. What mRNA sequence is synthesized from a section of DNA that is      3’-TTGACCT-5’?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Question 4. What is the effect on a targeted MRNA when it is silenced by a miRNA that has only a…

A: Introduction RNA is normally single stranded structure.Three types of RNA have been identified that…

Q: 8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time…

A: Answer :   Given in the image

Q: 1.What is corresponding amino acid chain of the mRNA sequence AUG-CGU-UCU-GCU GGU-UAG? 2. What are…

A: Eukaryotes and Prokaryotes store genetic information in form of DNA and RNA. Some of them have…

Q: 7. The following amino acid sequence represents part of a protein. The normal sequence and a mutant…

A: A mutation is a change in the nucleotide sequence of an organism's genome, virus, or…

Q: A. How long will the coding region of the processed mRNA transcript be? (Remember that stop codons…

A: A. In an mRNA exons refer to the coding region while introns refer to the non-coding regions. During…

Q: Part II. Transcription as a Process 4. Use the below "transcription bubble model" of a gene during…

A: Introduction:- Transcription is defined as the process of RNA ( coding as well as non-coding RNA)…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: Question 9 of 10 Question 9. If a mutation occurs such that there is a duplication of the A in the…

A: Introduction :- Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that corresponds…

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: 4. Look at the picture above. What do you notice about RNA's nucleotides (base pairs) compared to…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: Write an essay below to describe the process by which mRNA is formed. Use these terms correctly in…

A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…

Q: Adding methyl groups to DNA.. O increases the amount of protein these genes transcribe and…

A: The bases are ordered in the genetic information-carrying DNA (deoxyribonucleic acid)…

Q: 10. Protein expression can be blocked by antisense oligonucleotides. Which mechanism enables…

A: Antisense oligonucleotides bind to messenger RNA (mRNA) and prevents mRNA binding to ribosomes to…

Q: 1. Below is the sequence from the 3' end of an mRNA.…

A: Genes store genetic information in the form of DNA, which may be converted into functional proteins…

Q: How many codons are there in the mRNA?

A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.