8. Now that you have mature mRNA and it has exited the nucleus and entered the cytosol, it is time to transcribe the mRNA. You may use the abbreviations for the amino acids found in page 154 of your textbook C C G A T C C A DNA C T A C MRNA Peptide chain TI

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: . Code the following mRNA strand into amino acids AUGUGUCGGGACACAUAA

A: Introduction An amino acid is any organic acid that has an alpha carbon atom which is attached to an…

Q: The sequence below represents the template strand of DNA of the first two exons (out of 5) of a…

A: DNA is the hereditary material present in most of the eukaryotic organisms.The full form of DNA is…

Q: 15. The following is a list of some mRNA codons representing various amino acids. Met-AUG, Pro -…

A: The genetic code is the set of rules by which information encoded within genetic material,…

Q: 5. The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the…

A: Solution: the required labelled image is provided in the image attached below:

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

A:

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The DNA sequence shown below is for a very short gene with no introns. What is the mRNA sequence for…

A: mRNA Accounts for about 5%of the total RNA in the cell . Most heterogeneous of the three types of…

Q: 2. A molecule of tRNA with the anticodon 5'-ACC-3' will transport the amino acid the tRNA and the…

A: The genome is the genetic material of an organism that is passed down to its descendants and can be…

Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…

A: Transcription and translation are the components of gene expression. These two processes are known…

Q: Some events that take place in proteins synthesis are shown below: A. peptide bonds are formed B. a…

A: Protein synthesis involves transcription and translation. Transcription involves three steps…

Q: translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming…

A: Since you have posted a question with multi-sub parts, we will solve the first three sub-parts for…

Q: 1. Why Phosphate bond is important in DNA or RNA structure? 2. Why G-C forms three hydrogen bonds…

A: Molecular biology is the branch of science that studies various biological molecules like nucleic…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Enter the corresponding section of mRNA produced from the following section of DNA template strand:…

A: DNA or Deoxyribonucleic acid is the genetic material for most higher organisms and some viruses. RNA…

Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…

A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…

Q: Which of these is unique to how the MRNA is structured compared to pre-MRNA O MRNA combines with…

A: Note: As Per Bartleby Guidelines For Further Answers Please Repost The Question. Introduction: mRNA…

Q: Identify the parts of a mature mRNA Which of the following is found in the mature mRNA but not in…

A: mRNA It refers to the messenger ribonucleic acid which is single stranded RNA that is read by the…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: What does mRNA copy from DNA? * One gene's worth of nucleotides One chromosome's worth of…

A: Transcription is the process of synthesis of mRNA from the DNA. It takes place in the nucleus.

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…

A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Identify the parts of a matur mich of the following is found in nucleotides 5 can

A: mRNA or messenger RNA are polynucleotide molecules having backbone of ribose sugar and phosphate.…

Q: 29. Translation ends when O a release factor causes the translation complex to dissociate TRNA…

A: Translation is the process of formation of a polypeptide chain from an mRNA transcript. It occurs…

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…

A: Codons are the set of three nucleotides which encode a particular amino acid.

Q: Post-translational modifications of proteins may include which of the following processes? Hint:…

A: Please follow steps 2 & 3 for a detailed explanation of both questions.

Q: 18. Amino acids at the N-terminal end of eukaryotic polypeptides that contain information required…

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.