Thymine Cytosine Adenine Guanine Nucleobases of DNA Base pair DOODL Helix of sugarphosphates DNA Deoxyribonucleic acid Nucleobases RNA Ribonucleic Acid Uracil Cytosine Adenine Guanine Nucleobases of RNA

Q: Pairing an anticodon with a codon requires: Covalent bonding O lonic bonds Hydrogen bonding

A: Codon is the set of three nucleotides that are present in DNA or RNA that codes specific amino…

Q: Glycosylation is a major type of protein post-translational modification. Identify the amino acid…

A: Cavalent or generally enzymatic reactions takr place after or during translation are termed as post…

Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…

A: Replication, transcription, translation are the three processes of central dogma of life.…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns…

A: DNA- deoxyribonucleotides tRNA- anticodon and amino acids rRNA- ribosomes and protein translation…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What molecules are largely responsible for the universal feature of the genetic code?…

A: DNA is the store house of genetic information. This genetic information is expressed in the form of…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: hat is important about each of these carbons on the deoxyribose/ribose found in DNA and RNA? 1’: 2’:…

A:

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: Match the post-translational protein modification to its function.   Creates new binding sites by…

A: Post translation modification of proteins are modification  reactions,which involves the addition of…

Q: Which of the following is a nucleoside monophosphate? GMP Adenosine UTP ADPUDP

A: The objective of the question is to identify which among the given options is a nucleoside…

Q: RNA means: Ribonucleus Alkaline Ribonucleus Alum Ribonucleic Acid Ribonucleus Acid

A: RNA:  It is a polymeric molecule which is responsible for various biological roles such as…

Q: Which part of a deoxynucleoside triphosphate (dNTP) molecule provides the energy for DNA synthesis?

A: DNA stands for deoxyribonucleic acid. It stores the genetic information in form of nucleotides.

Q: The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between…

A: The propensity of nonpolar compounds to collect in an aqueous solution and keep out water molecules…

Q: ）picture1: what bond is this between cytosine and ribose？ 2）picture2 ： what bond is that bewteen…

A: Nucleotides are compounds made up of a nitrogen base, a sugar and a phosphate. The base can be…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: Nucleic acids involved in protein synthesis include DNA sense strand DNA anti-sense strand mRNA…

A: Nucleic acids are composed of phosphoric acids, sugars, and mixtures of organic bases like purines…

Q: In a Ramachandran plot, right-handed alpha helixes are usually in which quadrant? Top left Top right…

A: Ramachandran plot is known to determine the distribution of dihedral angle backbone of the peptide…

Q: RNA O is synthesized from 3' phosphate to 5'hydroxyl contains deoxyribose consists of the bases A,…

A: Answer- (4) Often forms base-pairs within a single strand. option 1 -It is incorrect Both DNA and…

Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…

A: Hereditary information and genetic information required for the healthy functioning of the cell are…

Q: Using the base pairing rules which three rna bases pair with the following dna codon TAC

A: The two nucleic acids, DNA and RNA, present in the cell are polymers made up of nucleotides. These…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the…

A: A nucleotide (pentose sugar + nitrogenous base + phosphate group) is a phosphoric acid ester of a…