What does mRNA copy from DNA? * One gene's worth of nucleotides One chromosome's worth of nucleotides One gene's worth of sugars O One chromosome's worth of sugars

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5-GATGTATA-3' Write the base…

A: Nucleic acids are the biomolecules that essential for the existence of life. They are the genetic…

Q: Why would a protein increase mRNA levels? How would you test that to prove your theory?

A: The Central Dogma of Molecular biology states that information is transferred from DNA…

Q: Which of the following statements about RNA are true?

A:

Q: language nitrogen bases Part 5: Translation - the 2nd step in protein synthesis language (A, U, C,…

A: Transcription is the process in which messenger RNA is synthesized with the help of the instructions…

Q: What are the difference between transcription and genetic code?

A: Transcription is the process whereas genetic code is a set of rules.

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: Why can’t the exact sequence of mRNA be determined from a protein’s primary structure? thanks

A: Primary structure of protein  Primary structure of protein is comprise of linear amino acid sequence…

Q: Which of the following is responsible for the ability of one gene to code for more than one type of…

A: During RNA Splicing: Introns -excised and exons - ligated together.

Q: What is the difference between transcription and translation? Transcription is the conversion from…

A: The genetic material is stored in the DNA of the nucleus of the cell.

Q: What is most closely associated with the cell organelle in the process represented in the diagram ?…

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: During the process of translation (protein synthesis), the mRNA strand is read From the middle…

A: Each and every protein that is made in our body or in any living organism is made by cell machinery…

Q: If a strand of DNA has the sequence A T G C G A TC C G C, then the sequence of an mRNA…

A: DNA is made up of 4 bases A, T, G, and C. A Pairs with T and G pairs with C. In the case of RNA, the…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription -…

A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins  mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Explain the features of mRNAs ?

A: Proteins within the human body are made up of a small chain of building blocks, which are termed as…

Q: The function of a gene is dictates the primary structure of a protein dictates the nucleotide…

A: Proteins :  Primary structure of proteins is the sequence of amino acids in a polypeptide chain.…

Q: A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the…

A: Answer:- (4) A 15% , U30%, G20%, AND C35%

Q: Translate the mRNA into a protein using the genetic code. (Amino acid chain.)   AUG( met)-UUU(…

A: Introduction The genetic code is a set of instructions that enable live cells to produce proteins…

Q: RNA O is synthesized from 3' phosphate to 5'hydroxyl contains deoxyribose consists of the bases A,…

A: Answer- (4) Often forms base-pairs within a single strand. option 1 -It is incorrect Both DNA and…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: How many ribosomes can bind an mRNA molecule and translate into a protein at the same time?

A: The m RNA formed at the end of the Transcription will move on to the cytoplasm for the translation…

Q: The genetic code derives its specificity through what interactions? O hydrogen bonds that maintain…

A: Genetic code: - Triplet - 64 different codons - 61 sense codons and 3 stop codons - Nearly universal…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: What property of nucleic acids do Phil Sharp's experiments take advantage of?

A: Nucleic acid are considered to be macromolecules and biopolymer which is very essential for all…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: Which of the following is NOT a property of the genetic code? O It specifies the amino acids within…

A: The genetic code is the set of rules that govern how the nucleotide sequence of DNA is translated…

Q: О ТАС. UAA. UAG. ALIC

A: Translation is a process in which a protein is formed. Translation occurs with the help of ribosomes…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: In order to know which proteins to build for a cell, RNA must locate (choose as many as apply)…

A: Gene expression is a complex process that involve replication, transcription and translation.…

Q: Suppose the coding (sense) strand of some DNA has this base sequence: 5'- ATATGTGG-3' Write the base…

A: In DNA Adenine, Guanine, Cytosine, and  Thymine are present as nitrogen bases. Adenine(A) binds with…

Q: n protein synthesis, why is it call translation? What is transcription and what does it do? What is…

A: Gene expression or protein synthesis involves two process transcription and translation.

Q: Which characteristic of mRNA is INCORRECT? Bacterial mRNAs vary in size but usually have about 1000…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: What is the mRNA strand of the following DNA (coding) strand: CAGGATGAATTGCTC

A: Gene expression is the procedure through which data from a gene is employed in the production of a…

Q: in lecture we learned that translation is the process of what happens when a strand of RNA is…

A: Translation  The process of translating the sequences of mRNA into the amino acid residues to form a…

Q: The primary structure of a protein is ultimately determined by an MRNA molecule an FRNA molecule O a…

A: The primary structure simply means the sequence of amino acids in  a polypeptide chain. By the…

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: Break down the mRNA strand into tRNA anticodons. Which series is correct? 6 ACCUAC CHIA CHIC AUC

A: Translating mRNA to tRNA: Decoding the Genetic MessageThe central dogma of molecular biology…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.