A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the complimentary mRNA strand? A 30%, T 15%, G35%, and C A 30%, U 15%, G35%, and C 20%. A 15%, T 30%, G20%, and C 35%. A 15%, U 30%, G20%, and C 35%. A 20%, T 35%, G15%, and C 30%.

A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the complimentary mRNA strand? A 30%, T 15%, G35%, and C A 30%, U 15%, G35%, and C 20%. A 15%, T 30%, G20%, and C 35%. A 15%, U 30%, G20%, and C 35%. A 20%, T 35%, G15%, and C 30%.

Name: A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the complimentary mRNA strand? A 30%, T 15%, G35%, and CA 30%, U 15%, G35%, and C 20%.A 15%, T 30%, G20%, and C 35%.A 15%, U 30%, G20%, and C 35%.A 20%, T 35%,

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 4QP: If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA...

See similar textbooks

Similar questions

The Human Genome Project showed that human DNA is not considerably bigger than much simpler organisms, with about 30,000 total genes. However, humans make over 100, 000 different proteins. How is this possible? (Hint: think about splicing.)
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the complementary DNA sequence that would form the double helix: 2. Write the sequence of the mRNA transcript that would be produced from transcription (use the original sequence, not the complement you just wrote): 3. Now, using the mRNA transcript and the table, write the amino acid strand produced from translation:
Which of the following describe how the order of nucleotide bases along a gene in the DNA ultimately determines the primary structure of a protein and how the primary structure ultimately determines the three-dimensional shape and function of the protein coded for by that gene. A Certain amino acids in a protein interact with other amino acids in that same protein and so the order of amino acids ultimately determines the 3-dimensional tertiary structure of that protein. B The order of nucleotide bases along the DNA is transcribed into complementary tRNA which is translated into the correct amino acid sequence for the protein by mRNA. C The order of nucleotide bases along a gene determines the order of amino acids in the resulting protein. The order of amino acids in the protein is called its secondary structure.
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
Several different nucleic acids are involved in the process of getting a protein produced from a gene. DNA contains the "genetic code" for the protein. DNA is double-stranded, but only one strand is transcribed into MRNA. The MRNA then goes into the cytoplasm where it is translated into protein with the help of TRNA. At each stage of the process, there is base complementarity (A pairs with T/U and C pairs with G) between the nucleic acids involved to ensure the integrity of the DNA blueprint for the protein being produced. Therefore, some of the four strands of nucleic acids involved will match (except U replaces T in RNA) and some will have base complementarity. Indicate whether there is matching (1) or base complementarity (2) between the following nucleic acids. DNA sense strand and MRNA DNA sense strand and tRNA DNA antisense strand and MRNA MRNA and TRNA
The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!