Which statement about the central dogma is FALSE?

Q: Which of the following acts as the “transcript” during protein synthesis?

A: Proteins are large biomolecules i.e. macromolecules. They are polymers of amino acids

Q: The correct order of genetic information transfer within biological systems is BEST described as RNA…

A: The correct order is best described according to central dogma given by Francis Crick. According to…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: Which process of gene regulation specifically effects the activity of a protein?     DNA…

A: Introduction :- A gene is a unit of heredity that carries genetic information from one generation to…

Q: The genetic code: UUC, UCU, CUU a phe, ser, leu. UUA, UAC, ACU, CUU A leu, thr, tyr UCU, CUC a ser,…

A: Need to say why the genetic code are correct.  It is converted from mRNA to amino acid.

Q: In which of the following would you find the start codon sequence of a gene? mRNA DNA and…

A: Codons are made up of three consecutive nucleotides. The sequence of start codon is AUG. It…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: Define transcription and translation. Give 3 ways in which they are similar and 3 ways in which they…

A: Central dogma of life is given by Francis crick in 1985.It gives an idea about flow of genetic…

Q: Proteins have a variety of roles. Which role is shared with elaborately folded RNA? Being structural…

A: Proteins are biomolecules that serve diverse functional roles within a cell. Proteins that catalyse…

Q: The genetic code is said to be "degenerate" because: There are more amino acids than codons.…

A: Genetic code refers to the triplets of nucleotides. The genetic information of mRNA is read in the…

Q: Which of the following is responsible for the ability of one gene to code for more than one type of…

A: During RNA Splicing: Introns -excised and exons - ligated together.

Q: Some Events Occur in a Cell During Translation   mRNA binds to a ribosome. Transcription completes.…

A: Translation is a process which means Protein synthesis And prior to this Transcription completes in…

Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…

A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…

Q: Which of the following mutations in a gene will most likely have the greatest impact on the…

A: Mutation is any change in structures or functional aspects of gene (genome ) which may occur due to…

Q: What is the difference between transcription and translation? Transcription is the conversion from…

A: The genetic material is stored in the DNA of the nucleus of the cell.

Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Which of the following best describes a sequence of events that happens during the elongation phase…

A: The translation is a process by which protein is synthesized using mRNA as a template. This process…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: Which of the following statements best describes the effect a nonsense mutation within a gene's…

A: Mutations are the sudden change in the DNA sequence which most likely alters the amino acids encoded…

Q: nonsense mutations add a stop codon, which stops translation at the site of the mutation. This makes…

A: Mutation can be defined as a genetic change in the genetic material of an organism, which results in…

Q: suppose that a gene has a mutation that changes one nucleotide. Because of this one nucleotide…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…

A:

Q: Define the following keywords: DNA MRNA protein. tRNA

A: The biological level of an organization is a hierarchy that arranges the living things from simple…

Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…

A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…

Q: As a gene s information is used to create a protein, which of the following is controlled by other…

A: A gene is the basic physical and functional unit if heredity and are made up of DNA.

Q: A point mutation within the DNA sequence of a gene, which turns the codon UGU (codes for the amino…

A: In genetics and molecular biology, it is vital to comprehend how point mutations in DNA sequences…

Q: A strand of DNA is composed of: A 30%, T 15%, G35%, and C 20%. What is the composition of the…

A: Answer:- (4) A 15% , U30%, G20%, AND C35%

Q: Regular insulin is ordered IV at 5 units per hour. The IV bag contains 100 units of regular insulin…

A: Pancreas is a leaf-like structure which is broader on one side and tapered on other side. It also…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: Which of the following statement about mRNA is TRUE?   Question 12 options:     mRNA splicing is a…

A: mRNA  The mRNA or messenger ribonucleic acid is the single stranded RNA which have code for…

Q: statement(s) describe the function of the protein encoded by  KMT2D ? Transcription factor…

A: statements describe the function of the protein encoded by  KMT2D are---- ##  The protein encoded by…

Q: What is genetic code? How many codons are there? Justify that genetic code is universal

A: The study of genomes' structure, operation, development, the mapping process, and modification is…

Q: Alternative RNA splicing is a process which increases the rate of transcription. allows the…

A: Alternative RNA splicing is the process which produces a combination different spliced sites within…

Q: Which of the following is an explanation of why a single gene in an eukaryotic cell may code for…

A: The production of RNA from the DNA template in the cell is known as transcription. Then the…

Q: Which of the following scenarios best illustrates Liebig's Law of the Minimum? Group of answer…

A: Liebig's Law of the Minimum states that the growth of an organism is limited by the scarcest…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: A codon is: three amino acids on a polypetide that are snipped off by the helicase enzy O sets of…

A: There are total of 64 codons coding for Amino acids.

Q: Some proteins may be phosphorylated by enzymes called kinases. Which of the following statements…

A: While, other options are incorrect:"Phosphorylation is an irreversible modification of an amino acid…

Q: Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking…

A: short double-stranded RNA again about 21-25 bases, would silence the corresponding geneThe RNA…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.