Q: The genomes of chimpanzees and humans are over _________ percent alike. Of the genes that are differ...
A: Genomics is the study of the entire genome of an organism and the pattern in which the expression of...
Q: Why is a blocking buffer needed while running the immunoblotting of the PDVF membrane? Why is skim m...
A: Immunoblotting (western blotting) is a fast and sensitive method for protein identification and char...
Q: why is behavior disorder in adolescent important
A: Growth is one of the life processes shown by living organisms.
Q: Letter drawn by group Mutation if any Result/Trait(s) A AAGGGCUUAUUC Extra long nails on digits B GG...
A: The process of gradual changes in organisms to form more and more complex forms over a long period o...
Q: Briefly describe (in 6-7sentences) what a plasmid is, and how it can be used to transform bacteria l...
A: Transformation is the process of addition of foreign DNA into bacteria. It was discovered by Griffit...
Q: a covalent bond When occurs between the active site (containing cystein) and the inhibitor (lead), r...
A: When covalent bond occurs between the active site(containing cysteine) and the inhibitor(lead),the s...
Q: equipments can be used to determine turbidity in the sample tubes in testing of antimicrobial act
A: The clarity of a liquid can be measured by its turbidity. so we can defined the turbidity as the mea...
Q: charge molecu Some bacterial pathogenic strains have the ability to evade the action does. of antibi...
A: Introduction :- Antibiotics are drugs that are used to treat infections caused by bacteria (bacteria...
Q: Exam Practice Question: Water samples containing phytoplankton were collected from 4 lakes in Alaska...
A:
Q: A density independent factor is something that affects the size of a popualtion regardless of its cu...
A: In ecology, a density-dependent factor, also known as a regulatory factor, is any force that influen...
Q: define the following epicotyl, cotyledons,
A: Embryo develops at the micropylar end of the embryo sac where The zygote is situated. Most zygotes d...
Q: Explain the relationship between cellular respiration and fermentation relative to lactase activity.
A: Lactase enzyme helps to digest lactose, a sugar found in milk and other dairy products into glucose ...
Q: An individual contracts an infection and this results in the production of soluble proteins that act...
A: Small protiens that play an important role in cell signalling, are grouped under a varied and loose ...
Q: In which tissue(s) is your protein NOT expressed in?
A:
Q: What do you think will happen if one level of biological organization is destroyed? Will it affect t...
A: The different levels of the biological organization have specific importance in the maintaining over...
Q: PLEASEEE DO THIS FASTT AND PLEASE DO THE GRAPH ON THIS PICTURE PLEASEE DO THE GRAPH ON THE PICTURE I...
A: According to the experimental set up, if we treat the root tips of wheat with or without aluminium i...
Q: Which of the following statements can be said about the enzyme telomerase? Select all the answers t...
A: The correct answers are : Option 2 Option 3 Option 4.
Q: Organisms in which of the following groups would you expect to not be saprotrophic? Group of answer...
A:
Q: DNA strands are anti-parallel and DNA polymerase can only synthesize DNA in a 5' to 3' direction. Ho...
A: Replication is the process of making two identical DNA molecules from a double-stranded DNA molecule...
Q: Which of the following correctly describes a Lichen? Group of answer choices A mututalistic relation...
A: In an ecosystem there are many type of interactions shown by the organisms. These interactions help ...
Q: complete the table below by citing some industrial fermentation products from microorganisms
A: We don't provide any references. A "microbe" is a living entity that is so tiny that it cannot be se...
Q: Match the terms with their definitions. 1. The theory that states that the conditions found in natur...
A: The natural selection is a process that helps in adaptation and induce evolution. Different types of...
Q: Exercise 3 The MTT assay is a widely used assay to study cell viability. It measures cellular metabo...
A: Eukaryotic cells have been found to be harmful to MTT. When cells were exposed to MTT, the shape of ...
Q: what is plant propagation and what is the importance of propagation
A: Majority of plants are sluggish to develop or germinate, or they are perennials with a short lifespa...
Q: Which of the following is NOT a reason why fungi can grow so quickly? Group of answer choices exte...
A: Fungi are heterotrophs that mostly grow on decaying organic matter. These secrete the digestive enzy...
Q: An indigent Mexican mother presented a two and one-half year-old child to an Emergency Room after a ...
A: Given, An indigent Mexican mother presented a two and one-half year-old child to an Emergency Room a...
Q: An example of a latent disease is: (a), Chickenpox/shingles (d) Gum disease (b) Tuberculosis (e) Lep...
A: Latent disease are those which can not detect by our immune system. Sweet make resident in our cel...
Q: The inside of the thylakoid is called the ______ and the outside is called the ______
A: Answer- Thylakoid lumen , Stroma. The space inside of the thylakoid membrane is called the lumen or...
Q: Describe the events that take place at the replication fork during replication of DNA of Escherichia...
A: Replication fork is Y shape structure formed during replication. It mainly occurs in elongation sta...
Q: Please select the word from the list that best fits the definition Harsh weather conditions includin...
A: Given conditions.. Heavy rains , strong winds, lightning and sometimes hail.
Q: What is the role of di-deoxy DNTPs in a Sanger sequencing reaction? Please select the answer that i...
A: Sanger sequencing is a method which helps in termination of chain and determining the nucleotide bas...
Q: Consider a diploid organism with three non-homologous chromosomes 1.) Which image depicts a cell in...
A: A diploid organism has 2 copies of same gene. This organism has three non-homologous chromosomes, t...
Q: What are the broad characteristics that distinguish a chemical substance from a hormone, and how can...
A: Chemicals are any substance that can get into a reaction to change or form another substance as prod...
Q: What is the sex of this specimen on its external features? Why do you say so?
A: Frog is an amphibian species which was developed various body parts according to the terrestrial nee...
Q: what is the main purpose of performing the bioinformatics analysis of 16s rRNA genes lab?
A: Bioinformatics: The application of computation and analysis tools to the capture and interpretation...
Q: these are major evolutionary transformations in animals, except a. tube within a tube plan b. euco...
A: Introduction :- Evolution is a slow , gradual and a never-ending or continuous process. There are ma...
Q: Scientists look at thousands of mutagenized flies, one at a time, under a microscope. They are looki...
A: Introduction :- Mutations are the result of changes in the genetic material of an organism and these...
Q: 2. If an A a BBC cdd male mates with an A a B b CcDd female. (a) What is the maximum number of activ...
A: In genetics the genes control the hereditary units of life. The alleles are the alternative forms of...
Q: The root of all environmental problems on earth today comes from: A The overpopulation of humans Hab...
A: Our surroundings are always changing. It is a reality that cannot be denied. Nevertheless, as our en...
Q: Explain anatomical position and the reason we use it. Use anatomical terms
A: Anatomy is a discipline of biology that studies the structure and parts of organisms. Anatomy is a f...
Q: A young child runs a fever of 40’C for 24 hours. Explain what effect this may have on his digestion ...
A: Introduction :- Digestion is the complicated process of breaking down food into nutrients, which the...
Q: This course is called "Ecology and Evolution". How does ecology drive evolution? How does evolution ...
A: Ans- The ecology field explores the interactions between species and the environment. It seeks to un...
Q: Question 19 2 Xb XBY XbY Which of the following goes in labels 1 and 2 in the picture above? O 1: X(...
A: Option A is the correct answer.
Q: Which of the following statements best describes an individual whose genetic make-up is shown below?...
A: Chromosomes are thread like structure present in the nucleus of cell. These are the hereditary struc...
Q: Can I please get help on proposing the next experiment (future direction) for the information provid...
A: Introduction :- Methylmalonic acidemia is a condition in which the body is unable to distinguish be...
Q: Describe the structure of the cell wall of a Gram-negative and a Gram-positive bacterium, respective...
A: A cell wall is a structural layer that surrounds some types of cells immediately outside the cell me...
Q: The primary purpose of the malate-aspartate shuttle is Choose one: O To move electrons from NADH in ...
A: In eukaryotes, the malate-aspartate shuttle is a biochemical mechanism that transports electrons cre...
Q: Which of the following enzymes is not involved in bacterial DNA replication? DNA Polymerase III te...
A: Bacteria is a prokaryotic organism that do not DNA organised as chromosomes. It lacks well defined n...
Q: Briefly describe the abiogenesis belief and one experiment to disprove it that was not always succes...
A: As per our policy, we are answering the first question only. For the rest of the questions, kindly r...
Q: Which of the following DNA repair mechanisms relies on homologous DNA recombination for the repair p...
A: DNA repair mechanisms relies on homologous DNA recombination for the repair processes are : SoS re...
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
sequenceIt could result in a single base substitution to give the new codon CCG. |
It could result in a single base substitution to give the new sequence AGG. |
It could result in a single base substitution to give the new sequence TGG. |
A transition mutation in the sequence CGG would always be silent. |
It could result in a single base substitution to give the new sequence GGG. |
Step by step
Solved in 2 steps
- Which of the following statements about a transversion mutation in the sequence AGC is true? It could result in a single base substitution to give the new sequence AGT. A transversion mutation in the sequence AGC would always be silent. sequencelt could result in a single base substitution to give the new codon GGC. It could result in a single base substitution to give the new sequence AAC. It could result in a single base substitution to give the new sequence AC.The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the aboveConsider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change in this codon create a synonymous mutation? Can a single base change in this codon create a nonsense codon?
- This sequence given is of one strand of eukaryotic DNA containing a hypothetical gene. The base that is first (at the 5' end) in the sequence is at position -25. The translational start site is the first initiating codon encountered after the transcriptional start. This gene has three exons. The last base of the first exon is the A at position +30; the first base of the second exon is the C at position +62; the last base of the second exon is the A at position +82; the first base of the third exon is the G at position +118; and the last base of the third exon is for you to determine. Determine, and show, the sequence of the polypeptide produced by this gene in this format: Met-Thr-Trp-Tyr-Val etc. 5'-TATATACGTC CTATCGATGC ATCGTGTACG TAGCTAGGGG ATGCATGAAG TCACAGTAGC TAGCTATGGC TGATCGATCG TTGTGGCTTA AATATTGCGC TGGACTAGGA AAAGCTCGCA GGTACCCGAT CGATCCCGTG GAGTTCCAAG TTAGGATCTA CTTTAGCTAG TTTTAGCGGA ATAAAGATCG ATTATAGCTG AGAGATAAGC GTGGGTTGAT GATCGTAGCT AGCTAGCTAG CTAGCATCGA-3'A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type phenotype. At the DNA level, this typeof mutation can be an exact reversion or an equivalent reversion. An equivalent reversion produces a protein that is equivalent to thewild-type protein in structure and function. This outcome canoccur in two ways. In some cases, the reversion produces thewild-type amino acid (in this case, glutamic acid), but it uses adifferent codon than the wild-type gene. Alternatively, an equivalentreversion may substitute an amino acid structurally similarto the wild-type amino acid. In our example, an equivalent reversionhas changed valine to an aspartic acid. Because aspartic andglutamic acids are structurally similar—they are acidic aminoacids—this type of reversion can restore wild-type structure andfunction.Here is the question: The template strand within the codingsequence of a gene has the following sequence:3′–TACCCCTTCGACCCCGGA–5′This template produces the…Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codon
- A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly describe these mutations? They are permanent and cannot revert or reverse mutate back into a wild-type sequence. They cause a non-functional amino acid to replace a functional amino acid. O They result in the insertion or deletion of a small number of nucleotides to the DNA. They change the nucleotide sequence of a gene but do not change the sequence of the resulting protein. None of the provided answers are correct. They convert a codon for a particular amino acid within a gene into a stop codon. They insert an additional amino acid into the final protein product.Help me pleaseAs described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′
- List all single base substitutions that would change a codon for Leu to a nonsense codon. For each, indicate whether it would be a transition or transversion. Second base A UGU Туг Cys UGC C UAU UUU Phe UUC UCU UAC UCC Ser UCA UUA Leu UUG UAA Stop UGA Stop A UAG Stop UGG Trp G UCG CGU CCU CCC CUU CUC CUA CAU His CAC Pro CAA Gln CAG Leu CCA CG CGC Arg CGA 2CUG CGG E AUU AGU Ser AGC ACU AAU Asn AAC Thr AAA Lys AAG AUC Ile ACC A. AUA AUG Met ACG AGA Arg AGG ACA G GUU GCU GCC GUC Val GCA GUA GUG GGU GAU Asp GAC Ala GGC Gly GGA GAA Glu GAG GCG GGG UCAG Third baseThe following fictitious double-stranded bacterial DNA sequence codes for a fictitious protein. Both strands are shown; the top strand reads 5' to 3' left to right, while the bottom strand reads 5' to 3' right to left. Transcription begins with and includes the red underlined A/T (top strand/bottom strand) base pair. This is a bacterial sequence, so there are no introns. 5'GTGTCCGTATGATATTGTGAGATGTTATATCCCGCCGTCAACACCATAAAACAGGATAATCGCCTGCTGGGGCAAAGGCGGTGAAGGTAAAGGTGTTGCC 3′ 3' CACAGGCATACTATAACACTCTACAATATAGGGCGGCAGTTGTGGTATTTTGTCCTAT TAGCGGACGACCCCGTTTCCGCCACTTCCATTTCCACAACGG 5′ a) Which strand is used as a template for transcription, the top or the bottom? b) What are the first 15 nucleotides of the resulting mRNA? Indicate the 5' and 3' ends. c) What is the translation of the first 15 nucleotides of the mRNA? d) Do the underlined nucleotides TAA encode a stop codon for the protein? Explain. e) A mutation occurs which results in the insertion of an extra G/C (top strand/bottom…A mutant E. coli strain is found with a mutation affecting some of its tRNA(Cys). The wild type normally produces a tRNA that recognizes the codon 5’ UGC 3’, and is charged with the amino acid Cysteine (Cys) (its notation is tRNA(Cys)). The mutant tRNA is still charged with Cysteine, but the mutation is in its anticodon that now has the sequence 5’- UCA-3’. How will some of the proteins produced in these E. coli cells be different from the proteins produced in the wild type cells