(hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the introns are not underlined. Draw the final mature mRNA's (ready to leave the nucleus) below each pre-mRNA. a. AUGGGGCCCAAACCCCAGUUUUAA b. AUGCAGUUGUUACGCOCAAGGCCCGCGCGAUAG c. AUGUCAUGUAUCAUGUAUGUAUGUAUGUAUGUAGUAUGUAGUAUGUUUGUAUAAA

Q: Anatomy and Physiology Question

A: The pelvic girdle and femur are important structures in the human body that play a crucial role in…

Q: fundus cervix external os

A: The image of the uterus is given in the question. The uterus is located almost overlying bladder and…

Q: Body symmetry: Drawing of organism: #5 Distinctive features: Domain: but ri to consider that all…

A: Sponges are multicellular organisms that are studied under spongiology. They are heterotrophic…

Q: The wrist is proximal or distal to the elbow?

A: The human body is a fantastic design. To keep one alive, millions of microscopic components…

Q: to treat a thyroid tumor

A: The cellular growth that occurs when the cells divide uncontrollably is known as cancer. It arises…

Q: advanced dysplasia?

A: The abnormal development in cell or organ of a body is known as dysplasia.  It can occur all over…

Q: IDENTIFY THE INTERNAL INTERCOSTALS A B A D C B D

A: The intercostal muscles are a gathering of muscles situated between the ribs in the rib cage. These…

Q: what is the groin?

A: In human anatomy, the groin is the juctional area between the abdomen and the thigh on either side…

Q: paralectotype

A: Introduction  Zoology is a branch of biology that focuses on the study of animals, including their…

Q: Bleeding, abnormal excessive fluid discharge  Ending -ostomy

A: Ostomy causes a change in the way urine or stool exits the body as a result of a surgical procedure.…

Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…

A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Identify # 11

A: The cranial nerves are a set of 12 paired nerves that arise directly from the brain. The first two…

Q: DISBAILITY

A: Disability refers to a physical, sensory, cognitive, or mental condition that significantly impairs…

Q: ABUSE AND NEGELCT

A: As frontline advocates, nurses help detect and address key concerns like abuse and neglect that have…

Q: PNLY POUT FRONT

A: Skeletal muscles are also known as voluntary muscles since they comes under voluntary control of…

Q: what trigersangina pectoris

A: Angina pectoris is a medical condition of chest discomfort.

Q: What would be the f2?

A: Drosophila has been widely used in genetic studies as it produces a large number of offspring and…

Q: Observe the structures above and answer the questions below. Please pay attention to the number of…

A: All these structures given are protein domain or motif structure and is part of many large protein…

Q: QUESTION 9 The following is a drawing of a Holliday Junction. A cut ( followed by annealing of the…

A: The recombination occurs during the prophase-l of meiosis-l that result in the production of…

Q: I letters

A: Differential stain is used is Gram stain. Gram stain uses two dyes Crystal violet and safranin. It…

Q: diathroses

A: The study of joint is termed as arthrology. A joint or articulation is a point of contact between…

Q: joint/breaking down

A: The region where the two bones meet is called a joint. This structure is generally mobile and allows…

Q: Metric

A: Metric system is a system of weights and measures. It is a decimal system of the measurement. It is…