Question 2. What recruits the enzymes that form the 7-methylguanosine 5'cap on the hnRNA/primary transcript as it is converted to an MRNA.

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…

A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: POST-ACTIVITY SKIL 1. The E2F family of transcription factors is important in regulating the cell…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: GQ16

A: The objective of the question is to identify the correct statement about the biological process of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.